Description :
Non Conding Region
Location :
Scaffold_1:104205- 104239
Sequence
34 bases(100 bases per row)
GAAAATCGAATGCAAACATTTGCGGTGGCAAACA