Description :
Non Conding Region
Location :
Scaffold_1:104099- 104611
Sequence
512 bases(100 bases per row)
TGGTGAGCGCGTACGACAGTCAGCAAGTTCGCGATGTCGTTCTTCGGGTCGGCGTCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNCTCGTGCCGCTCGGTGTCGCGGAGACCGCGCTGTTCGCCGCCGGCCGAAGCGCCGAAGCGCCCTCCGCGCGCGCACTTGGCATCTGC
TNNNNNNNNNNCTTGTGCAAATTGGGTTTTGACTACCAGACTGACGGATGCGGGGTTGCCTTGCTACCACAGNNNNNNNNNNNNTCACTCCCGTGCTCGG
CAATTGCACTGCGAACTTTGAGTCAGCCAGAGTGTGAACTTTGTACAAATGGTAGGGTAAAAATGCGAACTTTAAACAAATGCGCACTTTGAAAAGACTT
GTATTTTAGTTGTCAGTGCGTACTTTGGATACCGTACCTAGTCGGAAGGAAGCAGTGATGCGACGTTCAGGCTTTTCAAAGGATGGCGTAGAGCGCCTGC
CTGCCTCCACAT