Description :
Non Conding Region
Location :
Scaffold_1:104077- 105479
Sequence
1402 bases(100 bases per row)
cccccgacacaaagacaagagggtttgtgcggaggagggcccgtcccttaagtggcaacatgcttcaattcataaggagtttgtatgtgatctggtggtc
tttccacaccctgattctacaactgacctgcgtccggggacagcagaacatgaaatcggtggcgcaaagaaacctgtgacaccgaataatgcggaaccag
tatgcaatagttaacccttttaacgttgtgtttggctgtcagcaaattggtgagtgagatggttgagagaggagcggcaggtttcattgagagagcagcg
gaaagcctgtgcgttgcattgccgcgggatttgacaccaagaaagctgcggctgctgcctcgcgattgttgaatggcgcagtgcatcgtccgctggaatc
cggggacatggaagtgtccccagtctgcaacttgcatcctgggcggcattggctggtgggatcttggttgatctgcgttgacaagtagaaatgcagttat
ggtgcgtctgctgcatgctcctggcacgtagtagtgaaatcttatgagtcacgatggcgggaaacgttaaactgaactatatgtacttgttgcctttgtc
aatgcatgcaaaatggtccaggggtgagtttcactgggatcgaaagctagggaggttgagctctcaggtaagtttcatgtacggtactaatatgcaccaa
ttacttcgctccggcgtttttgctgcattttacagcaaccaaaaactatatctgaagacgtctacactttactttgctagtcaagatcgagtataacttt
agcacggcggtggtatgcagagcagaggtcagtgcagcagaggtgcctcaaatgagaagtggctggcaatttgtggggtcttggcggccaagttggttgg
aggtggcaaatgaaagaacttaaaaaatattctgtccgttctcagtctagcggatacgcatctcccgcaggttgacctgttgttttgcattgtgggcagc
accatagacgtccgtcttgtacccgagcaacacgacaaaaatatgctaaagcttttgccgtagcatcaaaaacgttccttattaattgaaagccaacatg
tagaacaggagtgaacagcctccaagttggtagaacagcttcaacttgcgatctttttcaagacgtcccaaaatacttaattcgccctacctaatcttct
gtaaatcaggttccaaataagccagttcaaattccgtcaatgagaattcgccaccagttcttgtttccaccaatccgttttctcagtcaggctgaaatac
ccaaaatacctcattaaacctcgctttaaaatccaaggtttttccttattttgtcgaatgaggccagagcgctgtgcttctccactcattattggattta
aa