Description :
Non Conding Region
Location :
Scaffold_1:103608- 106102
Sequence
2494 bases(100 bases per row)
GTCAGTGTTTCATCCTCCAAAATGTTCCTCCAAGTACCGTTTTCTATGGTAGGGGGAGGATTACCACACAGATTTGACGCTGTTACATTGTTCGTGTTCG
AGTCATCGAAGCTAATCACCATTTCTCTCGGTGGCGCGACGGAAAAATCCACCATGACGTGTTGGGAGGGCGCCAAGTTCAGCTCGGGGGCTGATAAGGA
GTCCAAAGCTTCGCCGTCCATCGAATCTAGCTTAGGCAACGACTTTCGCTGTGGCTTGGCGTCTGTAGGCACTTGAGGCTGGTCATTCAACCCCCCCGGA
ACAAGGCCGCTGAAGCTGTCAAGTCGTAATGATTCACCAGTTTTCCCGCTTTCGCAGCCTTCTTGTCCTTGAGAATGCCGTTGCTTTCGCTTTTGCGATC
TAGATGTGACGTGCTCCCGCAGCATGATATCCTCACGCCGAACTCGATAGTCCAGCGTTCCATCGTCAAACACAACCATGAACATCCCCGCTCCCAGATA
AGTGGCGATGTTTCCTGAGTAGAAGAACGGGGTTTTCTTGTATCGCCCAAATACGGCTTGTCCATAAGTCCATTGACTGTGCAAGGGGACAAATCGTGAT
GTGACCCCTTGTGAACCTTCGCTCGCTGGCGTTGAGCACTTCAAGTTTGGAATATCCGATCCTGATTCGTGAACGCTACGATCTTGATACTTATCATCGT
GCTGGAAATCGTGGCTGTGCTTAGCAGCTTGAACCTTGGGGTCCCACGTACCTGTAATTGCAATCGCTCCTGGCGCTGTTGAAATGACGTCGAGAGGTAA
TCCAAGTGGTGACTCTCTTTTGACAATTCCAACTCCATCATCGTGTACTAGGAGGCGATCACTTACATGTCGAACTGGCAAAGGTGGAGTATTCATCTTT
GGCAATGAGTCCTGCTTGCTTGCAATCGCTCCGTCATCATGGATTTTCATACGTTCACTGATCTGCCTGATCGGTGAAAGAGGGATTCCGATTTTGGCAG
TTCTATTGACGGGTATATCGGTGGTACGTTCTTGGGTTTGCTCTTGAACCGGAGAAGTTGGTCTACTTCTTCGCGGAGAAACTGCTGGCATTTCCTGCGT
GCTCGTAGACATTGCATCTTCATGAACTTGCAGCCGTCCACTAAGCTTGGCAACTGACGACTGCCGACTGGACCCGCTGCATCCCATCGTAAGAGATGCC
TCTTGCTTGTTTACTGGAACTTCGATGTCCTGCGGCTGAAGGCGCTCACTAAATGGCTGCGATAGCGAAGGCGGGTTGCTCATCCGGGGACACATCGTCT
CCTCCCAGGTAGGTGTCGCTCCTGGTTCGTTTGCTTGCAAGCGACCACTAAGTCGTGATGGCGACTGTCTGCTAGGAGTTGGTGGTCTTGTCTTCGGCGA
AGCCTCTCGAATTTCGATTGGGTCGGTTGGTGCAAGGTCATCATGGATCAACCGATGGCCCGTAGATTTTAAAGCTGATGATGGCCTATTCGTCGTGGGC
GACGTAGCTTTCAAAGGCTCGTTCTCGCCATGAACCACAAAGCGAGCGCTAGGGGGCCGAGATGACAGCGACCTTGCTGCCCTGGAGTCAGGTGTACCTA
CAGCACGCATCTCGTTGATTTGCCCACACACTCAACCCGCCCAATACGGTCTTCTACGCAGCCACGTTCACAGGGCTGACAGGACCAAAGAACCAGGACT
GCTAAGACCATTTATAGCAGAATCGAGAATTGATGCCTCGCTATTGTTGGGCATCCAAGTCCATCTTGTTTTAGCTGCCCAACGGCGACAACAAATCAAG
CTTGTGCTTGGGCATGATGCTTTCTTACATTTTTACGCTGCGTTCGCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNggcgttttgtgaatgcgacaatttctcggacacaggtacagtctggtacagcggcctaccgccctacactcc
gtcattcttaacgacgacgcgcagagtggtactctctacgcacaccgcacacccagcctaccgctccgttaagaacggccctcaATAGCCAAAA