Description :
Non Conding Region
Location :
Scaffold_1:103443- 113111
Sequence
9668 bases(100 bases per row)
GCAAAGAGGAGGTACTGGAGCTCAAACTTACAGAGTACTACATGAGCGTGTTGTGAATCTGTTCAATTTAAGGACGGTATAGATACGATTTACCAGCCAC
AGCAAACATCCGGTTTTCAACGCTGCACCGTTAAAAGCTTGTTCGATTCGTGGGTTCCGGGCAAATCAACTTGTGGAACCAGTGCGTTTCACTGCGAAAT
TGGTGGATCCGGCTAGCTGTTGAACACACATTTTAAGAATGGACGGTTTTGCTAAAGACCTCTATTGTACAAATCAAATGACCTGTTCCTCGCAGCCGTA
GTGAGAGTACGAACTGGCCGTGGTGACCAAGCTAAACTTCGAACTGTTAAATGCTGTTGTAGCCCAGCAGGCAGCTCGGGCGCCGATCGTGTCGAGTGAC
CGCTCATGCCGTACACGACGACAGTCAAGCCAACAGCGTCGGCAATGAACCGGGGATATGTCGACGAAAAAGCCCTCTTTAGGAAATTTTAGTCGGGGCA
GTGCTTGATCTCTCTTGTTTTGATTTTGGTCGTTTGACTTCTCATTTGGTCATGAAACGGTGTACTACTCTGTTCCACCAATTTATAGGTATTTCATAAA
TGGGGACTATCTTCGCTTCAACTTCATATTTTTGAGAAAGTGAGGTCTTAATACAAAGCTTAAAGCAATGCGCATATGCTTGATTTTTGTTGTTCAGTGT
CGGCAAGAATTGAGACAGTCACAGCACGTTTACCGCTACCGGATTTAGTCCAAACAATATTTTTTTTCGTGATTCCAACAAAAATTAGCGATAATTCATC
AGAATTCCAGGATGGCTAGACCTTGCCAGTGTTAGCTTTGCGAACCAATGAAAGCGTGTGAAAAGCTTTCGTGACCGAGATATTACGCCTCAAAATTGCG
AGGTTTTTCTATTCAGGGACGATATGATTGGCCAAAAATTAAACTGGCCCTAACCATCGTCAGATGGCCAATCAAATTCAGTGTGAGGTACACAAAAAAC
CTAACTACCTATAAATTCGTGGGACAGAGAAGTATCGTATTACACGAGATCTCTGCAGCCACGTATTTGATGCAACCGTGCGTAAAACTCAATTCACGAC
GAATGTAAAGGGCCCATTTACATAAGTAGGTAGAAGTTACATAGGTACATACACAAAAGTAGGTGCAGTCACACGGCTAGCGTGTGACCTGCTGTCATGT
TCTGATTGGTTGAAAGTGGGGAGCCATACCCATTTCATCCAATCAGGTGCAGACTTAGATTTGAGTGGTTCACAAGGGTAAGGGGGCCTCCGCCCCCGTC
CCATACATAAACAGAGTTGATTTTACCCTAAAGACAAGACTTGAGCTTATTATTGCAAGCTTCCTCTTATCTACAGTGTACGCTAGTGACAGTATCTCTT
ACCCCGTTACACCTGGTAGCACTTAGTAGTCCTTCCAACGTCCAAGACCAAGATGAGCCAAGTTCTGATGTCCGAAGGGTCCGGTGTAACCCTTGACCAC
ACGAGTTTTCCCCACCTCACCCGGATTGAGTGGGAAGCTCGTCACCGCCTCGCTGCCGTGTCTGGCGAGTTCGTCGTCACGTCGCTGCTGAGCTCAGCGA
CCGCCGACCAACAACGCCAGGCTGCCCAAGAGTTCATGGAACGCGAGCTCGCCGATGCCAAGCGGCGAGTGTCAACTCTCTCGCATTCCTCCCGGAACGA
TGTGGTGAAGATGGAGACGTCGACGTATTCCGGCGCCGGCCAAGACCGACTGCCCCTGAACCGCTGGTTCAGGGAGATCGACATCGCCATCGCCTCGAGA
CTGATCGAGGCGCCGACGGCGAAAGTGAACTTCCTCCTGTCGCGTTTGTCGGAGAAGGCGAAGGAGTGGACCCTCGGCAAGCTTGTTGTGGACCAACACG
CCTTCCCGAGTCTGGACAGTCTCCAGAAAGACCTTCGACTTGCGTTCGAGCCTCCGCAAGACGGATCGCGGATGCGTGCAGAGTTCTTCGCGTTGAAGCA
GGGCAAGCTGTCCATGCGCGACTACGTACAGAAGAGTCGTCACCTGGCCTCGTGCATCGTCACGAGCCCCATCGACATGGCTTCGCAGGTCCACGTCTTC
GTGTTTGGCATGCGAGAAGGAATGACGCGCTATTGTCTCACGCGCGCCGATACGAAGTCGCTGGAAGAAGCGTTCGCCCTCGCATTGCGCGAGGACTACA
CGGTATCCGCTTCGTACTCGCGACGGTTGCCGGCGGACGCTCGGGCAGCGATGCCCGAGCCAATGGAAATCGATGCCGTCGAAGCCGCGGAGAATAACCG
GCGGTACTACTCGCGCGGCGGCCGCAATTCCCGTTCGCTGACCTGCCACCGTTGTGGGAAGTTGGGTCATCGCGCGGCAATCTGCCGCGCGCCTGCGCCG
ATGCACGCTGCAGTCGCTCGCGCCGACGACGAGATCCTGGTCGTTCAACCAAAAAACGACCGGGACCAGTAGGTGCGGGGCGCCCTACTGGCTGGAACGG
AGGTCCGGGTCCCCCGGTGGCAAACCGATCTCCTAGCCCCCCCCCCAGTGCTTCACGCACACTTCAATGCCACCACCACCAGCGGCGACCACAGACTGAT
CATCGTCAGCCTGCACGTCGCCGGCGCGCGGCGTCCTCTCCGTGCGCTCCTGGATTCGGGCGCAGCGAACAACTTCTTCCGCGCCTCGTGTTTGTCGCTT
CTTCCCTCGGACATATCCGTCCGCGAGGGTCCCGGCGTCGTCGCCATTAAGCTCGCTGACGGCAAGCCACACCGTGTCCCACGGCGTGATATCACGCTGC
CGTACACGTTCGACGGCTTCCGTAGCAACGACGACTTCCTGGTGATCGAGATGAACTACGCGTTCGACTGCATATTGGGCATACCGTGGCTGACACGGTA
TCAGCCGGAGATCGCTGGCTGGCCCGATCAGTCATGCGTCGAGCCGACTACGACGCGAGTGAAGTGTTCACTCATCTCCTGGTCGCTCCGACGGACTGGC
CCCACGTTACCGTCGTGGATCGTTCATCCACGACGCAAGCCCTACACAGAGCGAGCGATGGCCCTCTCTGTATGGCATGTGCGGTGCTGTTGGATGAACC
GACAAATGAACGCGAAACCTCGCAGCGAAGCGAGGTTGTTGCGACGGCGGTCGAGCGAAGGCGACTCCCGCGAACCAACGAGGCGGTCGAGCAAGCGGTG
CTCCCGCGAATTAACGAGGCGGTCGAGCAAGCTGTGCTCCCGCGTACTTCCGGTGCGGACTCCGCACCTAGAGGAGGGTGAAGTATCGTCCAGCGATAGC
GACGATGTGTCGTCTAGTGCCAGCGGGTCGTCCACCTCGAGCTCCTCCTCGAGGTCTTCGAGGAGGAAGAGGAGGAAATCCAAGCGACGGCGTCTCAGGC
CACGGAACAACACTAAAACCGCACCTCCCCCGACGGAATCTGTCTGCGCTGTCGAATACGTGGAGGGTGCTCCACGGGGCACGCGGGTCATCGAAGTCGC
GAGTCCACCTCGCGACGCTCGCGGAATCACTCGGCTCCCCGGGCTCTCGTGGAAACACTTCCTTCGCGATCTGAAGGCTGGTGACATCGAGCAGGTGTGC
TTGATCACCGAGGCCGACGGGACAGCCGAGGGTCTTCACGCACTCAGCGGTGACGACGCGTCGTCGCGGCCGAGGAGTGCCGAACCGAAGTCTGCCCGCG
AAGAGCGATTCGCAGCGCAGTCCTGGGAAGCGCTGAAGAAGTCGGGTAACCCAGTCTACGATACCGCGCGCGAGTTTGAAGACGTCTTCCCTGATGAGAT
CCACGCCGAGCTTCCAGCCGACCGCGGAGTTCGGCACGAGATCGACCTCGCGCCCGGAACGAAGTACTGCGTGACGCGGCAGTGGCCACTGCCGCGAGAC
CAGGTCAAGGCCATCGACGAGTTCTTCGAAAAGCGCCGCCTGGCCGGCCACGTCCGCGAAAGCACCTCCCCACACTCTAACCCCACGTTCTGTGTGAAGA
AGGCGACTGGCGGCTGGCGCATCGTCCACGCGTTCAATAAGCTGAACGACGCGACCATCCCGGCACAGACCCCGATCCCGCGGAAGGACATGGTACTCGA
CTCCATGTCAGGTAGCGTCATCTATAGCGCCATCGACCTGACGGACGGCTTCTACCAGGTCCAGCGACATACCCCTCACGGCAGTAAGCACCCCCAGCGG
AATGCTTTGGGAGTGGCTCGTGATGCCACGGGGTCTGAAGAACGCCCCAGCCACGTTCAACCGCATGGTGTCTCACGTACTGCGCCCGCTCCGCGACTTT
CCTCAGTGCTGTCGAGGTCCATCTTCAACACTTGAGGCAGGTATTCCAAGTGATGCGCGAGAACAAACTGTACGCGAATTTGAAAAGTGCGTCTTCTGTG
CGCCGGAGATTCCCGTACTCGACTGCTACGTGAGCAAGGACGGAGTTCGCGCAGATCCGGAGAAGGTCACCTCGATCTGTTCTTGGCCAACTCCCAAGAA
CCTCACGGAGCTGCGTCAGTGGCTGGGTCTGGCGAATTATCTCCACAAGTACACGAAGAATTACGCCGGACTGATCCAACCGCTGTCTTCGCTGCTGAAA
AAGGACGCGACGTGGTTGTGGTCCCCCGACCACCAAGCTGCGTTTGATTCCGTGAAGAAGAGCTTGGCGGAAGCGCCGATCCTGATGCTTCCGGATCACA
CGAAACCGTTCCATGTCGTGTGCGACGCGAGTGATTTTGCAATCGGCTGCGCGCTGATGCAGTTCGACGATGAGGGCCACGAACGCGTCGTGAGCTACCA
GTCACGACAAATGAAGCCTGCCGAGAGGAATTACCCCGTCCACGACAAGGAGCTCCTCGCTATGCGCTACGCCCTGGTCAAATTCCGGGTGTACTTGCTC
GGAGAGCAGACATTTGCCGTGTACACGGACCACGCGTCGCTGCGCACCGCAATAAAGACTCCACACTTATCGCAGCGCATGGCGCGATGGCTCTCGTTCT
TCGCCGAATACAATTTCGTGGTGCACTACAAGCCCGGCAAGAACAACATCCTAGCCGACGCGCTGTCCCGCCGACCAGACTACGACCCACGACGACTAGT
CGGTCAGCAACTTGCTGACGACGATGACGAAGATGAAGGCTGCGCATGTTGCATCGCTCTGGGTATCAACGCGACGATTACAACTCCAGTCCTGCCACTG
CGCCAGCAGATTGCTGATGCGTACGAACACGATCCGTTCTACGCCAACATCATTGCGCACCTCCGTACTCCAAGTGCAGAGTCATTGAAGAAGCTGACAC
GCCCTACGCGCAGTCATATCGAGCGATACCAGCTCGATGGCCCATTGCTGACATACACAATGGACGCCTTCGATCCTCCGCGCGTCGTCATCCCCGCCGA
TGACGACCTCCGTGCTCGTCTCGTCCACGAGTATCATGACGCTCTAGTGGGTGGCCACTTAGGCCGCGAGAAGACGTTCGCGGCGATCTCGAGGGACTTC
TATTGGCCTCGGATGTACAAGTGGATTCGCAAATGGGTTCGGACTTGCGAGACTTGCCAGCGCGTCAAACCAGCTCCATCATCACAAGCTCCGCTGCGCC
CGTTGCCTATCGCCACGGAAGCGTGGCGATCTGTCAGCATGGACTTCGTATTCGGCCTTCCATCGGACGACCAGGGCCGCTCGGGCGCCCTTGTCATCAT
CGATCGCTTCAGCAAGATGGTCCGTCTTGCTCCTGTCGAAGCCCAAGTGACAGCTGAGGCGACCGCGTCCCTGTTCCTCGACCTCGTATTCCGGCATCAT
GGCCTGCCGGAATCCATCGTCTCTGACCGCGACCCTCGCTTCACATCGACCTTTTGGGATCGATTGTTCGAACTGCTTGGCACGCGCTTGTTGATAACGA
CGGCAGCTCATCCTGGAACGGATGGGCAAACGGAGCGCGTCAATCGAGCCGTTGAAGATGTCCTTCGCAGCTACGCCACGTCGTTTCCGTCGTGGAGTAC
GTTCCTGCCGCTCGCCGAGTTCGCTATCAACAACGCAGTCCATGCGTCGACATGTTTGACGCCGTTCTTTATCAACAACGCGCGGCATCCGCGCGTTCCA
GCGACGCTCGCCTTCGGATCTTCGTCCGGCTCCGCGCGCTCCACTCTTGGTGGGGGAGGAATGGATGCAGGGCCGAACCGCCCGGCACTCGTGTCGAGTG
CAGCCGAGCCGCGAGGGAATAGAAGCAGCACTGTGGCGTCAATTCCACCGGTAGCAGAACCGGTGGACGCGGAAATACCGGTTACGGCAACGGATGCCAT
GTGTGGAATTGCATCACGGACGCGTTCGAAGGCTAGAAGATCGACCGACACTGCGCCCGCATCTGACTCTGCCAGGCCACCGGCGGCCAACTTCGCCCCA
CGCGAAGCTGCTTCGCCGATCGACTCCGCAGCGGTATCGGAGTTCATGCTGCGTCGTCAAGCCATCGCGAGATTCGTGCGTGATGCGCTGCAGTCTGCTG
TGGATAAGCAGAAAGAGTACGCAGACCAGCGAGGCCGGAAGAACACGAGCGTCTTCCGCAAAGGAGACCGAGTCCTGCTGTCGACCACCGGAATCCAATC
GACAGCAATTACGAACCTTGGCGCGAACAAGCTGGCGCCAAGATACATCGGTCCATTCAAGGTTATCAAAGTGCTGGGAGACGCCTACACGCTAGACATA
CCGACTGCTATGCGTCTCCACCCGACGTAGAACGTCGGGTGGCTCAAACCGTATCTTCCTGCTGTTGTCCCCGACTCCCGTCCGTAGCGCCGCGGGCGGG
CTCGTAGTCCGATCCCCCATGACGTCGACGCTGACGCCAGCTTGGCCCAAGTCCCTGACGCTCACGCGCAGACTGTTCCGCCTGCGGTGCCCCGAATGCA
GCCCTCTCCAGACGACGGAGGCGCTCCACCAGCGCGCGTCGATCGTGCTGAGACTCTTCCGCCACTGCCTTGGCCGCGCTCGCCCGAGTGCGAGCGCTCT
CCGCAAGGTTCTGCGCGTCCAGCGCGTCGTTCTGGGCCTGCTCCGCCTCGGCCATCATTATCCGGTACTGCTCGATCGTCACCCGCGGCACAGACGCAGC
AGGATCCGAGCGCGCAGGTAGCTGATGAGTTGACGTGGCCGACGAAACCGGCGGCTGTTCGACTCGAAGGGTCGCGCGCGACGTTTCACCCCCATGTTCC
GCCCTACCGTCGCGATGGTCCACCCCCGCTGATTGACGCAGCTGGCGATCAGCGCTGGATTGCCGAGCGCATCGTAGACCATGACGTCCGCCGGAGTCGC
GAGGAAGGTCCTCGCGATAGTGATGCGCCGTCGAAGCCGAAGAGAAGCACCCCTGAGAAGCACTATCGCGTCCGCTGGCTGGGATATTCGCCAGCGGAGG
ATACGTGGGAGCCACGTAGTCGCCTGCTGCAGGATATCCCGGATGTTGTGCGCGAGTATGAGGCTACACTCGCGCTGGCGAAGACGAACGATGACGCGCT
GGAGAACCGCGTCCTCGCGAGTGACTGCGCTCGCGTGCCCCAGCCGAAGGCCACCCTCGATCACGACTGCGGCTGCGACGAAACTCCGGCGAAGGGTCGC
GGCGGTTTCGGCCGCGACTGTAATGACGATTCCGGTTCTCCGGCTCCTTGGAGGCTATAGAGCTCCCAGGGCTTGAGCTCGTGGTCCATCGCGTGGGGCA
CCGACACGAGCGACGGCGCCGGGTTCAGCGTTGGCCGCCCGCCGTTTCCGTCGCTTGAGCTCGACATCGACATCGTCGCTCGGCGCGCGTTGCCGAGTGT
TGCCGTCGGATCTTTCGCCGTTGTGAAGACTGTTCTCGAGAGTTCCGTGCCCGCGCTTAAGTTACCTAAGCGCAGCTTAGAGAGGAGGGTGATGTAAAGG
GCCCATTTACATAAGTAGGTAGAAGTTACATAGGTACATACACAAAAGTAGGTGCAGTCACACGGCTAGCGTGTGACCTGCTGTCATGATCTGATTGGTT
GAAAGTGGGGAGCCAGACCTATTTCATCCAATCAGGTGCAGACTTAGATTTGAGTGGTTCACAAGGGTAAGGGGGCCTCCGCCCCCGTCCCATACATAAA
CAGAGTTGATTTTACCCTAAAGACAAGACTTGAGCTTATTATTGCAAGCTTCCTCTTATCTACAGTGTACGCTAGTGACAGTATCTCTTACCCCGTTACA
ACGAAAATACCTGAAGTGACACCTTTTCCGTACAACCAACATCCATTCTTATTAAAGTGAAAAATCAGTTTCAGACTCTTCTTCTACGCTAACACAGTCA
TTCGTCGGCTCCGGAACTCTAGAAGTGCTGTCATCTCCTCGCGGTCTCATGGGCACGAGCCCTATCATAAAAAACGCAGAATTGTCGTAGTGGGCGGAGA
ATTCGTGGTTGAAATGGTAGCTGACGTCGAGGCTTCGGCATCTTGACTTGGACGAACGCATCACAGATACGTCCATTGGCTGAGCGAGTACTTGACCAGG
TGGGATCTACTTAGACCGCTTGCCTGTCCCGGGACTTGTCCCGATTGGTCCACGATTACATAGAGGTGACCCCCCTCCTCTTTGTATATTAACGATCAAT
GAAACAGTAGTGTACTGTCGATGACTTGAGGAAGATTACTGGTTAGAGGTAGAGTATGTTACACCTAGGAAGATCAATTTCTTTCGATGAGGGGATGATG
CCAAACAAGAGCCGCTTCAATCCAACTCGGGTTTACAACAAGGAAACCCCCCGAATAAGTGGGGCACCAAGTTTTATTTGACATGCTGCGCTAAGACCGT
GTACTGTGCCAGGTGAGTTTTTCTACTTGAGTTTCTGGGTACTCAAGAACTGATTATCTGACATTTTGTTTGTGCTTTTAGAGTTGAAGTGTACTGTGGC
AAGCAAAAAGTAGCCAAAAAAACATGTTGGACCCGCAGCGGTGGTACGCAATATTTCTAAGGTGTTGCTTGACCAACCAATGAAGCGTATGATCATTACC
GACAACTTCTATTCTTCGGTGGCATTATCGCTAAAGTTGCGATCGATGGACTTGTATCATGTCGGAACGGTGCGGACGAATCGTTTGGGGTGGTGTAAGG
ACATCCAATACACACAGAAGAAGCGACCAAAAACAATTCCGAGAGGTACGTACCGCATAGCGCAAGCCGTGGATCGCCCAGAGCTAATGGCGTTGTCCTG
GATGGACTCACGACCCGTCAATATACTAGCAACGGGCTGTAGCATGGTGCCGACATCAGTTCTTCGGACTGAAAAGGATGCGAGTCGAACGACGGTTCCA
TGTCCCTTCATGGTGTCTGAATATCTCAAGGGAATGGGCGGTGTAGAAGTCCACGATCAAATTCGGCTCCAGCGCTACTCGCTCCAAAAAACCGTTGCCC
TCCGGAAGTACTATAAACAACTTTTTCTCGGCCTCGTGGACATGACGGTTACGAACGCATTTATCATCTACAAGTTCATGCAGAAGAAGAAAAGAGAAAA
TGTGATCACACACGCGAAGTTCTTGCGCAAATTGCATACGGATCTGCTAGCTCTTCAAGCTTCGGACTTTACAACAACGGTTTCGGAAAAGAGATATTCC
AGTGGGCAGGCTGATGTGGAAAGCCACAAACTCGAGCAGGGTCAAGAACGTTATTCAAACCAGAAAAA