Description :
Non Conding Region
Location :
Scaffold_1:103429- 104217
Sequence
788 bases(100 bases per row)
GCAGTCGTACGACTTCAGCAAGTGATAACAACAGCAACTAGAGCGTCTTTGTAAACTGCGTCGATGAAGAGAACAGCACCCCCTCTCCAAGCGATCGAAC
GACTCGAGGGTGGCTTTTTGGATGGACCTATTTAACTGTCTCGGTCCCCCCCTACCACCACCACTGCTGCATTCCCTTCCTGCATCTGTCTTGCATTGCT
CCGCGAGCGAGTGCGTGGGCATGAAGCCTCGGATCGGCTCCGTTTTGGTGCGTGCGTGTGGTTCTGTATTGTGCGTGTCCGTGAACCTTTTTTCTCCCTC
AACTACAATAAAATGCCAACGTTCTTTTTTGCTTCTGACGCTGTGGTTGCTTGCTTGCTGGTCGTGCATTCGATTCGCCGAGTTGAGTATCGTGATGAGG
GAGACCTTGGCGAAGTATCAATGTGCATTTACTTTGTTACAATAAGCTCAGCAGCGGAGACCATATGCATACCATGATGGACTCGTGCTGATCCCCTCGC
TCGCGAACTCTACTCATCCACCAGGTATGTATCATACAGCACAGTGGCGTTGGCAACTCAACTCACAAGTGTACCCATGTTGGATGATGGATCCAAACCA
AGTCTTTCGTGATCTGCGACATGTAACGAAAGCAAAAAAATGAGAGGAGCCTATCATTGATCGATTGATCGGTCGCGTCTCTTCATGGCAGCAAGCAAGC
GCCAGGCGCGACAAGAGTTGTGCCTTGTCTTGGGCCACGAGAGACTCACCAGACAAGCGATAGAGAGCTAGTTGGTTGCCCTGAAAGA