Description :
Non Conding Region
Location :
Scaffold_1:103165- 103504
Sequence
339 bases(100 bases per row)
cgagccagctcagtccgcaggacctccagagactttatgaggttcgttttctttgtttggtgtttttacttgttgaattctaatatcatttgtgtgttgt
agctcatggataagcagcgacagggacttgaacacttgaccaatatccttaacgacgacctcgcggatatgcagcttatcaaagagacgtggcggcggta
gaaacgtcagcagtcaagatcaattaccacgtgatgcggcattgacttgtagctgttgttcttgtccttgaaatgcaattctacactctctcagagacaa
agggcaaagaaagctctggaagaccgcgactggcatgca