Description :
Non Conding Region
Location :
scaffold_1:102809- 104251
Sequence
1442 bases(100 bases per row)
TCTGAATCAATCAAAGGTTGTCACTTGGGCCGGAATTCCACGAATGCCGAGGCGATCGGTGTGGAGCCAATTGGAACGGCCATGCAGTGTAGGAATCCTA
ATTGGCTGTCGCACGCCCATAATCTGCAACGCTTCATTGCCGGCATGATCGGGTTGGCGGTGAAGCTTTGGCAATTGAAGCATGCGACAGACTCGACCGG
CTGCTGAGGATTGCTGCATGAAAGATCAAGTTTTCTGAAGCACTGAGATAAGGAATTTGGGATCGTTATATAGAGAGCAGTTATAGTTGTTCAATAAGTA
GATATATCCGAGAAAATGTGAACATATATCTCAATAAACAGGTGAATCAATAGAGGCCAGTACACATGTTGAAGTTTTTCCGACCTAGAGTAATCATAGG
ATGCTGCCGGGCGGCGGCAACCTGCACATTGTCTTCAAGACACCACCTTGCCATCGCACCAAGGGCTCCGTTCCCATTAGCTTACCATTTGGCGAGCTGG
TCTCCACCCGATCCGATCGAAGAGCATGGCACAGCACAGCAGGCGCCAGGCAATCGGCAATGGATGTGCGATTACGCGGTACAGACTGTATCCCGTACTG
TACACGATTCTACTTTCTCGCCGATGTGCAACGGATACATCTGTGGGCACTGCTCCAAGCAGTGCTCGGCTGCAGCAGCAGTGCAGGAGTTCGGCCGGGG
CTGCACGGCGCTGCCTTTGCCCTCGCCATCAACAATGCTAAGCTTATCTAGACTTGGGCACTTGCAGTTGGCGACATCTGCAAGTCGCTGCAATGTAAGC
GTGACGAAGATTATGGCAGCTGTATTGCCAACGGCGAAACGCGTGACGAAATTCTACAGTGGTCCGTTCAGTTGGCTTGATAGCCCACGCTACGGTTCAT
TTTGTAGTGCATGCATTTGACGATGCTAGCCAGCCATTGATTCAGGTGACCGCTTTGACTCCGACTTGAGGTGAGCATCGCCATCGACTCACACCAGAAG
CTCCTCCTACGGTCGTAAGTGCTCGGACTATTAGCGAATTCGACAATGAGCTTTTTCAATGTCATACATGTAGCGAGCGACCCGAGGCGTTATCGGCACA
GTGTAGTCCCAATGAGCTCTCAATTCGAGTCGGCAATAACGCCGTTAGACGGCAGTCAGTCCAACGCATCAAGTAAACGGGGCGGCAGAAGTGGACAGGG
GCGACGCGGTGTCCGTAAAAAGCCTACTTAGTCATATTGGTACCTCATAACGGGTACCTACAATTCCATCTAACGATATTACTACTTGTAAAAGGCTACT
AATTATTCCAACAACCTCTTTCGTTTTCCCCACACCTCCCAACAACACTGCCATCACCTTGATTACGTAATGTACTCGCATTTTAATCAATCTCAGCAGC
TGAACCTGTCAGCTCACTCTGGAATTCGATTTGCAGCGGCCA