Description :
Non Conding Region
Location :
scaffold_1:102573- 102671
Sequence
98 bases(100 bases per row)
TTTTTTAAGCAAACTGCGTTAGGAACTGCGTCGACTAGCAACCGTCGCGTCTGTTGAGCACAATAGCAACGTGGAAAACGTGACTGATAGTCTGCATT