Description :
Non Conding Region
Location :
contig_1:102374- 103815
Sequence
1441 bases(100 bases per row)
TCTGAATCAATCAAAGGTTGTCACTTGGGCCGGAATTCCACGAATGCCGAGGCGATCGGTGTGGAGCCAATTGGAACGGCCATGCAGTGTAGGAATCCTA
ATTGGCTGTCGCACGCCCATAATCTGCAACGCTTCATTGCCGGCATGATCGGGTTGGCGGTGAAGCTTTGGCAATTGAAGCATGCGACAGACTCGACCGC
TGCTGAGGATTGCTGCATGAAAGATCAAGTTTTCTGAAGCACTGAGATAAGGAATTTGGGATCGTTATATAGAGAGCAGTTATAGTTGTTCAATAAGTAG
ATATATCCGAGAAAATGTGAACATATATCTCAATAAACAGGTGAATCAATCGAGGCCAGTACACATGTTGAAGTTTTTCCGACCTAGAGTAATCATAGGA
TGCTGCCGGGCGGCAGCAACCTGCACATTGTCTTCAAGACACCACCTTGCCATCGCACCAAGGGCTCCGTTCCCATTAGCTTGCCATTTGGCGAGCTGGT
CTCCACCCGATCCGATCGAAGAGCATGGCACAGCACAGCAGGCGCCAGGCAATCGGCAATGGATGTGCGATTACGCGGTACAGACTGTATCCCGTACTGT
ACACGATTCTACTTTCTCGCCGATGTGCAACGGATACATCTGTGGGCACTGCTCCAAGCAGTGCTCGGCTGCAGCAGCAGTGCAGGAGTTCGGCCGGGGC
TGCACGGCGCTGCCTTTGCCCTCGCCATCAACAATGCTAAGCTTATCGAGACTTGGGCACTTGCAGTTGGCGACATCTGCAAGTCGCTGCAATGCAAGCG
TGACGAAGATTATGGCAGCTGTATTGCCAACGGCGAAACGCGTGACGAAATTCTACAGTGGTCCGTTCAGTTGGCTTGATAGCCCACGCTACGGTTCATT
TTGTAGTGCATGCATTTGACGATGCTAGCCAGCCATTGATTCAGGTGACCGCTTTGACTCCGACTTGAGGTGAGCATCGCCATCGACTCACACCAGAAGC
TCCTCCTACGGTCGTAAGTGCTCGGACTATTAGCGAATTCGACAATGAGCTTTTTCAATGTCATACATGTAGCGAGCGACCCGAGGCGTTATCGGCACAG
TGTAGTCCCAATGAGCTCTCAATTCGAGTCGGCAATAACGCCGTTAGACGGCAGTCAGTCCAACGCATCAAGTAAACGGGGCGGCAGAAGTGGACAGGGG
CGACGCGGTGTCCGTAAAAAGCCTACTTAGTCATATTGGTACCTCATAACGGGTACCTACAATTCCATCTAACGATATTACTACTTGTAAAAGGCTACCA
ATTATTCCAACAACCTCTTTCGTTTTCCCCACACCTCCCAACAACACTGCCATCACCTTGATTACGTAATGTACTCGCATTTTAATCAATCTCAGCAGCT
GAACCTGTCAGCTCACTCTGGAATTCGATTTGCAGCGGCCA