Description :
Non Conding Region
Location :
Scaffold_1:102349- 102423
Sequence
74 bases(100 bases per row)
TTCGTATCCGTCGTTAAGAACAGAATCCATGGTCTCTTCTTTCCCGCCACATCTTGTCAGTCGGTGGTCGGTGA