Description :
Non Conding Region
Location :
Scaffold_1:102297- 102544
Sequence
247 bases(100 bases per row)
CTTTCTTTTGAAAATGAGGATCTGCAACAACTCCGTCCATCCGGATAATTAATTGTACAAGTCTCCATTACTGTACCGTATACTGTGAATCGACCTTCCC
ATTCATCCGGACAATTGTACAAGTGTACCGTAAACTGAAACGACCTCGGATTGGTCTATTAACTTTGTATAATGACAAATAAAACCAACTTATTTCATAT
ATGGTCATTCTTATTGGCTGATATACATGGAATAAAATCCATCATAG