Description :
Non Conding Region
Location :
contig_1:102056- 102436
Sequence
380 bases(100 bases per row)
GAGCAATTGAACCTAAGTAATATTCTCGTTGATTCTTCTCGTCGGATGAACTTGTACTTCATTTTAATGAGTACTGTTGTGAATTACTGGTCCTCACCGG
TTGCTACTGTTGCAGTTTAGCTTTTGTCTTACAGCAAGTTGAAGTGTAGATACACAAAATGCTCAGGAGCTGGGAAAGGAGAGAGAAAAGCAAAGAGGGG
GAAAACCACACAACAGAAAATACAACGGGAGCAGCAAGTCGCTTTACTCCCTCGCCCCGTGTTCGTCTTCTCTTTCTTGTTCGTTGTGCGGTGTGAGTTG
CTGACGCACGCAAAAGCAGCCAAGTTACAAGTGGTTATGAGCCCAAGGCTGGGTTGGTAACTCCCCGACGGTGAAGATCA