Description :
Non Conding Region
Location :
scaffold_1:101616- 101697
Sequence
81 bases(100 bases per row)
ACGAGGTAGTACAAGACGCTGGTCGAGTAGGGCTTATCAATTTCGAACTTTTGTTTCCAAGTTGTGTAGTATACTACGTGT