Description :
Non Conding Region
Location :
scaffold_1:101451- 104049
Sequence
2598 bases(100 bases per row)
AGTTACAAAGAGCGAATAAAGAGTGGACAGTCCTTCTACTATGCAAATTGCTTTTTGCCAGCGGTCGCTTTCCCCCGGTCACCCCTTCCCCTGAAATTGC
GAATCATATATACATGTGAAAAATACTTCTGcgaaatttaaattttggaCCTGCAACCGTTTCCAAAATAGATGCCCCGTCACTTTCGCTTTAAACTAAA
CGGGCGTTGGAAAACGTATGGTGCTTTTGCTGTTTGAAGGCGGTCATCCCGCTGGACGCAACTGTGACTCAAGACAAAAAGCGCTTCCgccaaagatttt
tttccgAGCTTTTACCCATGAGCGCCTTGGTTTTGTACGGAACAAACTTCTTTTTTGCACAAACAGTCATTCCTAAAAATTATGCCTTTTAAATTGTTGA
AGAATTTCTCTGCCTCAACACAATCATTAGTAGGcattttttaaatattttcGTCGCCTCTTTGATGTGATCCTGCGTTTTACCACGCAACATTTGAGCG
AAAGAGTTACCAGTAatcgaaaaagaagaaatttttaCTGCCAAAATTGTGGATTGCTGATCCCACGAGCTAGTAGAAGTAATTTTAGGATTGCTTCCCT
GGCGCTGTTACACATGTGCAGACCGACACTATACTACAAGCTTACACTCGCGTTTTCCTATAGCCACGACCCGTAAATTTGGCGATTGCTCGTTCGAGAG
GCGCACCTCCGTTGCGTGATGCGATTGATTACCTGCTCTACTTGGATCACAAATCTATTTTAGGAGGAGCAATAATCTAATTATGAGAAGTTCTTCAGGT
TTTTGCCCAAATTTTAATTTGCGCTGCCCATTTAGAGACGATATTTCCGTCAGCGACATTGAAGAAGAATGTTGTCGATATGACACAACCTTGATATCAA
GCCTGCGGGTGCGAATAAGGCTTTATGAATCTCGCTGCGGCCGTGCTGCTGACACATCCTTTGCTCAATCACTGTGGCCAAAACTGTCTACCATTCAGAC
TATGGCCTATCATGTCGGCCAAGCGAATGTGCTATATTTTGTGTATAGCACCTTTTTAGTGCAATTAGTCTACATCTGCCGAACGGTGCAGCCAAGGGCT
CCAcgcttttaaaaaaattgtcactaGTTGGGATGTCACTTCCGCTGTGCGTCTATTCCCCTCGCCAAGACTGCGCTGAGACCGTTTGGCTTAGTCGATT
TAAAGGGTATCTTTTTCTAGTTTGATTTAATGTCAGCCGATGCTTTGATACCTTCGTAAAAGTTGTTTTCGATTTGGCAGCCAGTCTATTAGCATCAAGA
GTACGAATGATTAGGGCACGTCCATTGTCTTTTGATCGAAGTCATTCTCTTTGCTTGTACAACGTGCGTAGAAGTCGATCCTTTCGATTGAACGCAACTT
TAACATACTTTCGATTCAAGCGTTTGTACGTGCAGGCGCTTTTTCAGATTTGCTTGCGTTCAATTCTCATGCTCAGACCCGTCTTTCAAAGCCGTCATCG
TGATCTTGTAGGATTTTAAGTAGAAAAGATAAATTGCTTCGGAGACGAAAAATAGAATTCGTCTCGGGCACGAAGAGTAATGAAAACTTCGCAAGATTTG
CAAATTTTCGCAAATTCGCGTCATTAGCAATACATTTTCTCTGTTGCAGATTACGGGTAATCCCGATAGTACAACGCCAGCGTCAATTTACTCGTTCCAA
GATCTAATCGCGCTTTGCTAGGTACTAACCGAAAGGATATATTTTAAGTGTAGCTTTTGAGGCCTCTTAGCAGAACTTGGACGCCACCGTACATCACTTG
CTGTGAGCACGTCCATGCCCGAAATAAGCAAACGATTTTTAAGGCCGCACATATGACTACTGGAGCTCTAGGAAAATGTCAATGGTTGGTTCTTTGCAGG
CAACTCATATTCATATGTGCAACTTCAGATAGTATAAgaaagaaagctttgacctGCTTCTGCAAACTCTTCACGTGCACAGTTACAGCACTTAAGCTCG
TTGCTTAAGCACAAAAACGTATTTTGGTAAAATAGCACATGCTAAAATATTATGGGTTGCACAATCGGCTTCAGCCACGGTTTCTCATGGCGCCGAATTA
GCCTCGGCATTACAGCGCGGTAGTTGATATGGGAAATATATTACAAATGTAGTTGTTCCATTAAGCCGTTTCCGTCAGGACATGTTGACAATTTGCCGGT
GTTGTCTATGCCGACCATTTCTGTCACAGATCTTTCTTTTCGTTGCCATCACACACAGCATCGACAGCTTCGACATCACTGGCAAACTCGTCACCGAAAG
CTATAGTTGTTAGCACGGCAAACACTCTGCCGGACGGCAGAATGTATACTCAGCCCGCTAAGACTAGGTAGGACACACACTCTGTGACTTGAGTAGTATT
TTCGTTAGGTGATTTATCGAATATTTCGGCTATGCCAAAAACATGCGAGTTATATTTTGGAATTTATTGTGTCCTTATTCAATTCATTGATGCAGTGCAA
TTGTTTCTTACATGTAACTTTACACAGGACATTATTGAGAGCTGTACGTCGAGAGATACAAGCATAATCAGACATTTCATCGTGTTATCAATTCTACC