Description :
Non Conding Region
Location :
Scaffold_1:101414- 102610
Sequence
1196 bases(100 bases per row)
tcttcgccttttgaagctgaagaatttggatcggagtgtaatacgattcagttattggatataaatgcgatcattttgaccaattatataatcgcaattg
agcgccaagcatctcgaggtttgctggacgaataagctgtcttagccccgcgtcgcctctagaaaccctcccccgcgccaccaacaggtaatatgcagca
tataagcactgttatcgtatagaggagacgcgtgtgactgcaacacagcgtttaaacctctctacttcgctttacagacagatatattatagtttgaaac
tgacttctattgctaatgttgcaatgtattaggtacacacaactcagtcatgtttggggctacggcaggagcgacacagccggcaactggtggctttagc
tttggtgcaggtgcggcagcagcacctgccgcttccggtggcttcagctttggcgcgacacctgcagctccagcggcggctcctgctactggaggcttca
gcttcggagctgcagctcctgcggctccagctgctggctcaacaggttttagcttcggtgctactccggcgacgagtacggcagctcctgcagcttcttc
agggttttcctttggtgctactcctgctgcagctcctgctgctagtacaggcttcagcttcggaggtaccagtgcagcccctgctgctagtagcggtgga
ttcagttttggaggagctgctgctgcacctgcagcgtcgagcgggtttagtttcggtggagctagtgcagcccctgctgcaggtagcacgggatttagct
tcagtggagcgaccccagcagccagcacaacgtcgtcttttggattcggtaatactacagctgccaagccttctcttttcagtcaaaccccagcagcgac
tagcacagcgacgactggctttggcttcggagctaaaccgacaactccaagcactggtttcggattcggtactactccggcaactggcactagcactttc
ggaacggctggtactacaggatcttcgctgtttggtgctgctacgcctggagcaacgccctctgcatttggcgcagctccagcagcttcgactgctcctg
ctccgatcatcctcggtgctgacgcctcagtagcccaactcaacacagtcaaggcagcgtatcaggatcccgcacagtcgcggttcaagttcctca