Description :
Non Conding Region
Location :
Scaffold_1:101017- 102178
Sequence
1161 bases(100 bases per row)
GCTCCTGCCGCGGATTTTTGTGCTGATGCGGTGAATTCGTATTTACCCCTCTATAAGAAACTAACAATCCCCTTTACTAGAGAATAAATGCTGGTAAGGA
CAGAACCTCACGCTAGCCTGGCACTCTCGTTCATGACAGTGTTCTGGTTGACACTCGTATCATTTTTCAACCATGCAAATTATAAAATTTAGGCGGCACC
TGCCAGTAGCATCAAGCACGaggtcgtctgcgacttacGCCGGTGTCGGTGTATTTTTGCAGAGGCTATCAGCGAGAGATTTGGTATTGTTTTAACGTCA
GCAGTCCTCATCGGCATTTACATTTTCACGACAGCCTTATCTCGTTCGAGGGTTGACTGGACTTGCTGGAAAGCGCTGACACTGCTGCAACGATGATGGT
TCCAACATCGAGCGCATGGTTTACAAAGAGTCAATGACATTCGTATCGAAATGGTGCTTACTTTCGAAAGGGATGCTCACAAGTTGTAGACATGGGAGTA
AGAAACAAGAGTAACGAAAAACAAACCTAGTGTGCTTCCGTTTATTTTCTGCTAGCACCGAACACAATTTTTCTTCAACATCACTGAAGCCATGAAGAGA
ATGGGCTCTTCGACATCACCGTAGCCATGGCGAGAATAGATGCTAATGTGAGGTTTCATGAATATGGGCGGTGTTTAACTCACTACAGCTGCATTTGTGG
CTTGATAGCTTGTGTTTGGAAAACGTGGCGGAATGGACAACTTCAGGCACTTCAACACCTTGACTTTAGTCGGCCAGACACGAGCGATCTCTCTTTTCTC
GGGGCCAGAATTCACAGTGCGAAACATAGATAGCACAGCAGTTGAGAATCGGTAGCGGTGGCAACGTCTCGTCAAGTATGCACGAAAAACCAGAAATTTG
TAGGGAATGAAGTGGTCGTCCATCTAAAGTGGACACTTGCGATATATCCTGGATATTTACCTACGCAAAATGCGACATGCGCTTCCACTATCCGGATCAG
ACATACTAAACTCCAGTCATTTGTTTCATTATCCGGACTATCGTCCACTTCAAACTCAGAGATCTTCAGCCTTGTCATTTTCGAAGCAGCCACGTACTCC
GCAAGTCTCCGCTTGAACCAGGATACCCTCTCGCCGCCTCAGACTCgctccaccatcgcca