Description :
Non Conding Region
Location :
Scaffold_1:100811- 103187
Sequence
2376 bases(100 bases per row)
AAGGGAATTGAAAAATGATATCCTTGGGCCACGACCAGCTGCGATGGCGTTTAAACGCATCGTATCTAGGTTAAAAGATGGAATGATGGTCGCGATGACG
ATGGACAGGCGCGCCGTCGACACGGCACAACGAAGTAGTCGAGTGCCATCACTTGTACGCACAGGTGCAACACCGACGCTCTTCATTACCGCGGTGCGGT
CTCGACGATCAAGCGTCAGAGGTTTTCTTTCTTGCCGCTTTCCTGCCTACGCAGACTGCGACATATCATTCTACAACGACGTACCGGTAGCTGCGCTGCA
AATGTAGCGGTATGCCAGTCCCCTGGTACTAGAATTATCGTAGAGTCCAAGGTAGGTAAAGCGCATTTTGTTCAGCATTTTGTAGGTGTTGTACAAGCAA
GATTTTGTCGGGTGTCCTGCACTGCGATCCTCCACGCTTGGCACTGAGAGCCATGGGTTCAACCCTTCTAGTACCTGGGAACCTGGTACGTTATCGCATT
CTATAAGATCTGTGTCCAAGGTGTCGCTTCCACGACACGATGCGAGCAAGTCGCTCGTCATGGGCAGTGGTCGCCGACGTCAATGGCCGTCACTCGCTCC
AACCTGCATTTCCGTTTTACCTATAAAACGCATTTTGGTCAAAGGTTTTTCACCAGCAGATCGTAGTGCAGCTGGTCGGCGAGGCCTGGGATTGGCTCGT
TTCGCGTGGCGAATCGACCGCGTTTCGTAATCGGGTTTATGGCGGGTCGCATGGAAGCGGTGCCATGATGACCAAAAGCGCATCAGTTCGTGATGGACGC
CAAAGGAATCGGGAAAATGCATGTGCGTGTCAACACTGGGGATCGGCGTCTGAGAAAGGGCAGCTTTTGATCTCTTCGGACCGGCATTTGGTAATCAAGC
GCCGATTTCGCGCCGACTTCGCGTGCTCGTCGAGGTCCCTACACGGACAAAAGGACAAGACGACAAAGGAAAGCGCTATTCTGAGCTGTGCACATTATAA
GTTTTTTCATGTCGAGTGCCCGCGATTAGTTGATGATGGACCGAAAGGCTGTGTCTAGAATATGGGACTGGGCTGCAGGATCTCAAAATGCGACTTCAAT
ACTCAAGAAGCTCCACGAAGACTGTTGCGGCTCCTGTTGATTTGGCGACCACGGGACAGCGCAATCGAATTTTTGGTATTTTCTTGTCGAGTGCAATGTG
GATTGGTCAGTTGAAGAATCGTGGTCGGACATAGACATGTTGTCAAATGTGACCATTTGACCCTGTCGAGTCGACAAGATCGCACAGAAATCGCAAACTT
CGTCATCGAATAGCACCAAGTTGCATGTCGCGATGATAGACAGAAGGGAAGTCTGCGAGAAGTGCTGTTGACGTTAGTACATTTCTGCAACTGCGCATTT
CAGACGACACGAGCCCCTTTCGAAGTCCTTCACTTTCGTTCACGAGGCAAGCCCTGCGTCATTTCTCAAGTGACTACGGACCTTCTTGCATCTCGACTCT
TGTATTTGTGTTGTCACTAGGAATAAGAACTCGTTTCAACTGGCTGCAGACGGAGCGCATGAAGGTGACGACGTAGAGATGCCCGAGCAAGACGAGTCCT
CCTCGGTCAGCGTCGATTCGCCAGGTACCGTCGCGAGGTGCATTCAAGTGTGAGCACTCGGCGACTTGGTGGCTCTGTATTCGTGGCTACTACACGAGGG
CTCGCTATCCTTGCTTGAGCATCTCAATAGAGCACTTTGCGCGTCGTTCGAGGCGCTGGCGATCCTCTCTTGTGGCAGCCCAACGAAACGTCATCCGCAT
TCCAGCCTAACACAAGGAGCTTTTGTACGTAGCCGCAAGATTGGACGGCGCTGCACCTTTCAGCTCCCCACCAAAATTCATCACGCACGAAGCAGAGTTA
GTAGTTTAACTTGTCATTTGTATCACGCTGCACCGCCATCCACCCGGACAACATCTGGCGACAGAGACAACGTGTGGCAGGTGCTGGTGTTTGCTCCGAG
CCAAAGCTTTACATCGCGGCCCGCAAGCAAATGCCACATACACGATGAAAAGCAGAACAGTGACGTTGGTACCTCCTTGACGCCGAGCGCCAACGCTCAA
TCAAGAGAAATGTCGATTTGACATGAGTCTGGGAGCGATAACGCCCATGATCTGACATCAGACGGTCTTGCACCACATCCAGAAGCGTAGGTTATTCTTG
ACCACTTCTCTTGACAAGTGTTCTTCCAGATTAGTAGTAAGTATCAGGAAATGGACTGGTCGTCCCACACTACTCGCTTCAGCTTTCTGCTGCGCGGGAG
ACCGTCACTTGGGCCACACCGCAGGACACCGGAAGTGTCCACGCAGATCGCATGGTTCATTTTCACATTTTCTCGA