Description :
Non Conding Region
Location :
Scaffold_1:100548- 103370
Sequence
2822 bases(100 bases per row)
AACCAGATCGCAGTTCCTGCCCCACCTCGAGTGGCTGACGGCTTCGTTCTCTTCCGACCGCGAACATTGTCACTATTGCTGCCTCTTCTTGTATAATTAA
CTGCGTTGCCGGCATTGAGAGCTCCACTAGCATTGCCCGTCCGGATGGCCAGATACGCTTTCCATATTGGCGCTGCAAGGTCACCACAGAGTGAATCACT
GCAATCAGCATCATAACCATTTTGCAATCAATCTATTGTCATGGCCACGCACCTTCCGTGGTCGACGCCGTTTTCTTGACGGAGGAAACGCTGCTTCGGG
GCATCATGATCGCCGCTCGCCAATAGTTGCAATGTTTTACGGATTACGCGGGTTACCGTAACCCGCGTAATCCGTAAAAGTTACGGTGGAAGTCGATACG
TAACCTTGGGTTACTTTCCAAGACGATGGCGGACATCCAGCACAAGCGCGTGGCGTTGAAGCTCAAGCAGGCGTGCGAGGAGACGGCGGCGCAGGCCATC
GCGGCCACCACCGCCAGCGGACAGGCGAGCCGCATCCACGGCAAGAATCGCAAGTTTGGCAGTCGGAAAGAGGCCACGGCAGCCAAGGCAAGACCACCAA
AAGAACCTGATAACTACGGCCAGGATAATAATCGCTAAAACTATGCAATCATTGGTATTGTAATTCATGCAGATCGCAGCGGCGAAGGCCAAGCGCGAGG
CAAAAGAGGACGAAGCAAAGTGAGGACCCTCTTGGCCCTATAACGACAGGACCAGTGTTAGTTTGGCGTCCACTTGACTAGGAATAGGAGGAGTTTTTCC
GTTTCAATGTGTTTTACAAAAAAACATTAGGTTTCACCGAGGTGGTTCATTGATTGAGCTACGGGTGGCAACGGATGAAGACTCGACGCTCCTGGCCAGT
GGTCCGAGCGCTGGTGGCGAAAAACTGGACGATCAAGAGACGTCACCCGTTCGCGACGTGGAGCGAAGTGCTAAACCCGTTGCTTTGCATTCTATTGTTC
GTGGCGCTGAAGAGGTTTGAACCCGACCTAGACATCCCAGCAGGGTGGGCGACCAGTGACGCGAACAGCTCTGCTCCAGATCATGGCTCCTCTTGGAGCC
TCTTCAATACTACAGATTATGCGTCGTCGCTCGAAGAAGGCTTGAGTAGCGTCGGAATTACTTTACCGGATAATTCTGCGAGTGCGAGCAACAGCAGTAA
CAGCTCATCGACCGGAATGTCGGCAAATGCACTGCTGGAGGCCCTAAGCAATAGTCTACGAATTCCTCGGTTCTATTTCACGGAAACGACTATGCCGGGG
TTGCTGCTCAGTTTGTCTCTGCAAGCTCTCATGGAAGGAGACAAACTTGACGAATTGGGGGGCGACGCACTGATGGATTGCGCACTAAAGTTTCTGCTGC
TAGGTTACACGGGAGCAGCACGAACCATGTATCACGTGCCTGCTGCTTGTCAAGGAAAAGTGGTGCCGTACAAGATCGCCATCACTCCTGACACGCCGTA
TACGCGAGAGTACTTTGCCACAGCGTTAGAAAATTGGTACCCGCGCATAGCTCTTGCTCCAGCCATAAGAGGCATTTCATTATTGACGATTCCAAGCTTC
ACCGACTCCCATGTATTTTTCGACAACGAGACAGCCATGGAGACGTATATTTCCAGCAAAGAATACGGCACGGATGTCGACCATCCAAAGATTTATGCAG
CCATTGCCTTCCAAAACTTCCCGCAAGATACTTCTGCTTTTGGGGATTTGAATGGCTACCCGATTGAATATTCCCTGCGATTCAACTCGACGGGGAGCTT
GTCATCTGTGCCAAAAACGAAAAAGCCGAGACCCAGTCAACAGCTAAACTTCGCACCAGCGGAGGGTACGATGGCGTACACGACGCGAGGGTTCATGACT
CTGCAGACATTGATAGCACGCTTTCTCAATTGCATGCCAACGTGGAACGTTCAGGTAGGTTCAATTGACGGGACGTGTCAAGTCCATCAGGCTGTTATGC
CAGCAGATACAGAAAATGACCGCCGACTGCTGCTGCAAGTGGAGAATGATATGCTCATCGGCACAGCTTTCACATTGCTGAACACCGTCAAGGACTTGAT
CACTGAAATGGCTTCCGTGAGCCTTCCGAATGTCTCCGTGGACACCATTCCAGCATTGAGTGTAGAAACGCTTTTGGTACCGCTGCGCATTGCACCCCAG
TCTTTCCACGGTGCAGCCGTCTATGGAAGTCCTACACAAGCATTTCGCTATGCACCATTCTTCGGTAAGGTTGCGTTGGTATTCCCTATAGGCTTCGTTC
TCTCTTACCTGTACCTCGTCTCGCGTGTCATCGTGTCCTTTCTCATGGAAAAGGAAACGAGATCTCGAGAGCTCATGTGTATCCTTGGAGCCCAGAATGG
CGAACTTCTTGCTGGTTGGGTGCTTGCTTACGTGCCAATTTTACTGCTAGGAGCAATACTCCAAACGCTAGGGGCACACGGGTTACTTTTCCCAAAATCA
GACGTCAAGCTGCTGTTTATATTCTTCTTCACTTTCGCGACGAGCAGCTTTAGCTACGGCTTCATGATCAGCACCTTATTCTCGCGGGCACGAGCAGGGT
CACTAGCGGGTATGGGCCTGTTCTTCATGATGTTTTTCATATCTTACAGCTTTAACAATGACTCCAGTGAGTCAGCTCGAACGCTCGCTGGATTGCTCCC
ACCGATTTCGCTTTCTCAAGGTGTCAGTGTGATCGCCAAGCTCGAATCGTACGATGTAGGGGTGACCAACGAAAACGCGAACGAAGAAGTCAACAATTTT
CGGTTTGCAAACGCTGTCGGAA