Description :
Non Conding Region
Location :
Scaffold_1:100468- 102459
Sequence
1991 bases(100 bases per row)
TCAACAGAGTAGTTTCTGGAGGCTGATTGGTCAAACTGACAACCAATCAAATAGATGTATGTGACCCGTATCTTGAACAATCTTACGACAGTCTCGTTAA
GTACGAAAGAAGACGTTACGAACTATTTCGTCAGACTTTGTGAAGGATTGTGATATAATCTGTGGAGCACCAGAAGATCTACGCGATTGTATAACAGGAA
AGATTTCACTTATTATTGGATACCTATCAGTGACTTCATCTGCGTGCCAAGGCTTGACGAATTGTCATCAAAATGACTGAACACCCGCCACAAAGTGGGA
GTCAGTCGACCGAGAACGAAATACAGCAATTAGCGCTAGCCAAAGAAAAAGAAATGTTGTCTTCTTCTAATGGAGAGGCTGAAAATGGAGATCTTTTCAA
GGATGAATCAGGCGCGGAATTCGATCTGAGGAAGGTAATGCCTCATTGTGTGACTATGACATCCATGGAGACGGTCGGCGTTCCGACAATTGCTGAAACA
AGGTCTTCTTCTTTCTCATATTGTGGAGACTTGGCGAATTACAGTTTTCGTGTTCGACCAATTGTGGATGTGATTGCAACCTATATGAATACATCAGACA
CACGCGTGATGAGGACTGATTTGATGCGAGCAAGTGGTACAGTCGTTTTATCTCAGCGTAAGCGAGAATTGATTGTTGATCCATTCAATCTCTAACATGT
GCTGAATACTGACTGTAGGTAATCAAAATAGGGTCCGTACTTCATCAGCCTTGAGCAAAGAAAGTAGTGCTGAATGGGGATGGTTTGCTGATATCGATAG
CAGTACTGAAAGCTGGGGAGCCGATGGATCGCTGCAATCACTGAGAAGAAAATTAAGCGTCGAGCTTGGATTAGTTGATAGTGGAAATGCTGTGCAAATC
TTGGGTGATGAACAAGCCAATCCGCGAATCACAGCAGCTCACAAAACGTTTACCATTGCTATTGATGGGAAACAAAAGGTTGTGTCGGGAACAATCTCAA
TACCAAAATTCCGTATCGTTCAGTCTAGATCCGGTACGGATAGACATGCTCAGTATTTGATAACATTTAAGCTAGGCAAAGACTTTTATGCCGACTGGCG
TCGATATTCCGAGTTTGGTGAGTTGGCCAAAACTTTGCCTGTCGATAAGTTTGAACGAACGCTTTCCGCGTGGAAGAATATTGACACGAGATGGTTCAAC
CGCTTGGAACCTTCGTATCTTCATCAAAAATGCATCACTTTGGAGAATTTCATGCGAGAATTAATGTACGAGTCGAGTGAGGCTGGGGTACTTATCACAG
CCGCGTCACGAGAGGGAGTTGTTTGAACGTATGTGGGCAGAAAACTTCAAGCGCTCCTGTGTGAACTATACAAGCCCTCCTTTAGACAAGACACAAGAAA
GAGTGGTATTTAAGGCTATTGAGCATTAAAAATCGTCATTATTTAGTTTCTACCAATGAGTGATCTAACGAGCGATTCGCCGTTAGCGATTCCGAACTCT
GCTCAGTCGAGTCGACTTGAAAGTCTAATTCATCTCATACAAGGTTCCTTCCTTGAGTTTAGTGCATGGAGAAGCTTGTCCAATAGCGTGTTAAGAATGT
AGAAGGCAGTTGTTCTGAAATACGTCAAAATGCAGCAGAAAAACTCGGGCAAGTTGCTATAACGCTGCCAGAATTTGCTGCCTGTATTATTGCAAAGGTG
AGCGCTATTTGCACTCTTATTACAAAATACTTACGAGATTCTAGTTGCGCCCGCTTTTTTTGTCGCTGGAATGGGACACGCGAGTTGCTGCAGCTCATGC
GCTTGGCCCAATTGCTCGCTACTTGATCAAAGAGAGTACGACCTGCGAATTCCAATCGACTGGCGTCGTCTTTCAGCGTATAGCCCAGGTTTCGTGTACG
AATTTTATCCCTTTACAAAGCAGAAGGTTAAGTGGCTAGCTTGCAGTAGGAATCGATCAAGCAGAGGCGACAGACGCACATGCGTTGAGTA