Description :
Non Conding Region
Location :
Scaffold_1:100320- 101039
Sequence
719 bases(100 bases per row)
AGAACGCGTTCTTCGGTGCACGATGTAATTCAAATCACCGTTGAAGTCGAGAGCAGTACTCTTGTTGCTGCGTCGGCACTTCCAAATATCGCTGCTTTCC
TGTCTGTGATTTCGTCGTTTGTGAGGGCACCACTGCTTGTGACGTGGCTTTCACATGTACTCGTGAAACATTTTGTCGCGTACGTGCATGCTGCTTCCTC
CAAGCGTGCCCCAGGAAATGCCACTAGATCGGTTGGAGCCTACCACCTTGTGCACCAGCACTGGTCTTGTGGAGATTCAGTTTGGTAGTGCTTGCTGCAC
ATTCCATTTCCCCCCGTGCAAAGCACGTATCACTTTTGCTTGGCACCGCTGCCATAGCGGCCATCGCTACGATACGTGTGTACGAATGACACCTTTTCGC
GTTGTTGGTCGACAGTGGTTGCGTCCAAACAACGCTCGTTTCAATGACGATTTCCCACCGACAATAACTCCATGACTCCAATAACGACTGACAAGGGGCA
CTTGTCTGGGCAAGACCTTGGCTCGCGGCGCTATCCCCGCATGTCGGCGTTGCCAGGCGCAGGTCAGAGCGGTGATTCGTCGTGGTGGCTATGGTATACT
CCATTTTTATTTTGACTGGTTTTCTTAATCTTGAATTGATTAAGAAATTAAATTGAATTTCGAATTCACTGGCTGTTTGTATGAGTTCGACTGCTTCCCA
CCCAATTTTGAGAATTTCC