Description :
Non Conding Region
Location :
Scaffold_1:10021- 10116
Sequence
95 bases(100 bases per row)
CCTTATGTACTGTTAGGGTTTTGACGCTGTTTGATTGGCTCACCCGCTGCAAAATATCTCACCTGACGATGTCAACGCTGAATTTCAAAAATACC