Description :
Non Conding Region
Location :
Scaffold_1:100206- 103090
Sequence
2884 bases(100 bases per row)
GCCGCTTACTGTAGTGCGTCGGCTCGGAGCAGCATTCTTTCAATAAAAATTCCAATAAGAAATGCATTAATACATAACCTGACAAACTAGATATCATTGT
CTCACATTTTGCTATTAAAATAAGACTTAATTATCCTATCACCTTGGATAATAGCTACAGGTTTAATGTTTCTTTTAGTTTAGCGTTGCTGTACGAAAAC
GTGTCACTGAAATGAACTTTTTCACATTTTCATATTAATGACGAGGTAGAGTTGAAGTTGCCGGGTATCTTAGCTCAGCCAAGTTAGCTGCCCGTGAACG
GCTCGCAACGGCGAGGACGAGGTGCTGGTGCCATGCCGCTTGTTCGCTAAAATGGGACGCATAGGTTTGAGGATGCCAGGCCCGTCTACGACGATGAAGT
ATTACCATGGCTGCGAGCTAAATGGGGCAGCCTTCGGATCAGACTACGCGTCATATCTCTTGGTGTATTTCCGTCGAGGTGGTCGAAGCTTCTTTGTGGG
CGGCAGTTCTGCATCACACACGAGCTGAGCGGACGGAGGAAGAAGCGCGTTGCGCCCAGTTGAGCCGAGTGAGCAGCGATGGACCCGTTCGCGGCCATCG
CCGTGACGCCGATGGATCCGGCGGCCGAGGTGACTCGGCTGAAGGGCGAGGTGCAGGCCAAGGACGAGGCGCTCAATACTCTCAAGGCCAAGACCAAGGC
GTTCGTGGACAACATGCGCACTCAGCTGGCGAACGAGACGAAGAAGGTGACGGCGCTCGAGGAAAAGCTCAAGGAGGCGACGACTGCGGCGGCGCCGGCA
GCGGCTGCAGCGGACAACAGCGAGGAGAAGCAGCGTCTTGCAGAGGAGATCGAGAAGCTGAAGAAGGAGACCGCCACGCGCGAGAACGAGCTCAAGACAC
GAGCCAAGTCGTTCGCAGACGCGATGAACTCGCAGCTGGAAGCAGAGAAGAAGAAGTGCCGCAACCTCGAGACGCAGCTACAGCAGAAAACGGAGGCTCT
CGCAGCGGCGGAAGCTGCGAAGACTGCTGCTGATGAAGCGAAGGAGGCGGATTTCCTATCGCAGCCAGCACCCGCTGGTTCCCACACCGACGAAGAGTTC
AACGCATTGCAGGCTCAGCTGAACACGGCAAACTTCGAGATGGCAGACATGCGCGAGCGTCTGCGCAGTGTGGAAGCTGAGGCATTGCAGTCATCACAGC
AAGCAACGAGTCTCCGTCAGGAACTTGATGCGCTTCGTTCGTCTACGGAGCAACACCGCAATGCGTTGCAAGCAGAGGTTGACGCCCTGAAAGCTCGTGA
GACCTCGCTGACCGCCGAGCTCAGCTCTCAGCAGTCTCAAATGAAGGCTGAAGAGAATGAGGCCGACGTGGCTAAGATGAAGGAGCTCGAGTTCCAGCTT
GAACAGCACAAGATCGAGAACCAGCACCTTCAGAAGCAGCTATCGGACAAAGATTACCACCTCGAGCAGCTGGACAACTACCGACTGAGAGCGGACGAAA
GCGAAACGAAGGTGCTCCAGAGCCAAGCGGAGATCGCCTCGCTCCAAACCCAACTTCAGGCTAAGACGGACGAGTTAGCGTCATATTCGTGCGGCAAATG
CACGGAGCTCGAGGACAAGCTTGCGGAGATCACTCAGTTGTACGAGAAGGTCAATCTGGGCAGAAGCCGTAGCGACAGCTTGATCGCGGAGACTCAGTCG
CAGCTGGGTGAAATGCAGACTATCAAGCAGCAGTATACGGCCGCGCAGGAGCGCCTCGACGACATGATGAAGCAGAACCTTACACTCAACGAGAAGATTT
CGGAAAAGGAGGTCGAAGTGACGACGCTGAAGGCCGAGATGAAGAAGTGGAGCATGGAGATGGCCGAGCTCCAGGCACAGCACACGACTCTCAAGTCGGA
CACCACGGAGCACCGTCAGCGCTCCGAGTCGGTCCATGCCGAGTTTCAAAAGGCGGAGGAGTCGTTGAAGGAGTTGCAAACTCGCTCCGCGCAGCTCGAG
AAGAAGAATCAGGAGCTGCAGGCGTCGATCGAGGTCATCAACAAGGAGAACACCGACAAGCGCCAGAAGGCCAAGGCCCTGGTGCAGTCGCTGGTGAGCG
AGAAGACTAATTTATTGGAGGCGAAGAGTGAGCTGCAGAAGGAGGTAGACAGACTGCGCATGGAGGTCAACCAGCGCAATGTCGACAATGAGCAGCAGGT
GAAAGAGCTTCGAGAGCAGAGCAACGAGAAGGCAGCGCAAAGTGCGTCAACGATCCAGAGTCTCACCGATGAGATCGCATCTTTGAAGCACGCTCTCGCC
ACTGTTCAAGAATCCGAGAAGGCTCAGCAGCGAGCGAAGGACCTCGCTGCAGCCAAGCGCGAGATCGAAGACTCTAACAAGAAGCGACTGGCTGCAAAGG
CTGAGACGCAGAAGCTCGCTGCAGAGCTTGAAAACGTGCACAAGAGCCTCGACCACATCACGACGCATGTCAACGCCAATTGCACGGAAAACATCCAGCA
GATTGCTTTAGTCCAAGGCCATGTGAAGGAAGCTCTCGAGGTTTTGGAGAAGCGTGCGGGTGTTGCCCAGAAACAGCGCGCCGAAGACGACACGGCCGAA
ATTGTGCGCAAAGCGGAAGCTCTTCGAACCGGCAATGGCCCACAAAGTCCCGGGTCAAAGCGACTGGAAGAAAACGTATCACGTGTCACCGAACAGGTTC
GTAGACGCCCTTGCTACGTTGTTGTGTCTGCTATTTGACTGACTCGCATTGTGTGTTTCTTGAACAGATCCGGCAGCTTGTGGACATCACCGAACGACTA
TGCGATATCGCGGTGGAGCAGAACGATAGCAACCTGAAGGACGTGATCATCAATAAGCTGACCCAGACGTTCACGCAGTGCTTC