Description :
Non Conding Region
Location :
Scaffold_1:1- 51
Sequence
50 bases(100 bases per row)
GCGCCCGCATTCAACGTCGGCTCTGGCATCTCGGGCGACTGCCGACTTCA