Description :
Non Conding Region
Location :
contig_1:1- 433
Sequence
432 bases(100 bases per row)
GATCCGGATTCCTGGTCCAACACAGCGTCCAAATCTTCACAATTAACAGTGAAGCCAGGAAGAATGGTACCACCATCAAGATCTCTCCACGCGCTATTGC
CAACGCGTCGAACAAGACGATTTCCTCGGGCGTATCGCTTGTATTCGTACATGATTTTGTTCTTTGGATCAATGAGCCATCCCAATTGCACACCGTGAGG
AAAGTACTCGTGCCGCATCTTGTGATCGAGAGCATCAAGCTTGGAATGTGGACCAGTGAGAGTGTCGATTTCCACCACGAACGTCGGAGCAAAAGGTTCT
CCACCACGAGTCCATCGTTGAGCTTCGGTCAGCTGCCTTGCATCATCTCGAGGCACATACGCCACATCGGGGACCCGAAGCGTTGTGCCATCCAGCACGT
ATTCATCTAGCGCATTTGTCACTCTTCCACCA