Description :
Non Conding Region
Location :
scaffold_1:1- 4315
Sequence
4314 bases(100 bases per row)
TCTCGTGGACGATGTACAGCACACCGAGGGAGgagtgttggaaacaagttaagtcgttcctaagtaaaccaggaggagttatgaaactccTAACGATTTG
CACAATTAGCTAGCTATAAGCATAATACATTTACTTGGAaacttaccttcaaaccaccaggNNNNNNNNNNagttagcagctctttgtcgaatGTGGTCG
ATAAAATTGAAGCTCTAAAGGAGCAGACAgatgagggtgacaccggacgacgcggagtgcgtgttcaccccggcctcagaggcgacggcgacgccgtatg
ctggctgcaagacaccgggcgtcgaccctgatccagggtNNNNNNNNNNTTGTCAACGGGTAGAACCCTCTCCAAACGCGGCTActccgctggccagctt
accggtatccactgggtgctgacagtccatgagtttggactttgtgtttggcctgtcgaaagattcggcaggcaacacgggtgtcgtggtggtcgtcgac
cggttgagcaagatgacttgtttggcggcggtgccagacaccatcaatggagtcggtacagcaacgctgttcgtgtatcgtgtttttcgtcaacacggac
tcccggagtcgattgtctctgttAAAGACCCCCGATTTACGGGAAAAACTtagtcgactatcttcagggtgctaggCACTACGCTAAATATGTTGACAGT
GGATCttccacagaccgatggtcaaaatgAAAGGgtaaatcgcgtcatcgaagacgtatttcgcagcgtctgcgctgagacgtcgagacgctggagcgcc
atgttgccaatcgtagagtttgcactgaacaatgcagcgcatttgtctaccggctacacgccgttctacgtgaacgggctaatTCACCCTCGTGTTcctc
tgacgccgccatcccatggctcatggcttggtgggggaggaatagccgaacggctcgctgatgtcagccccctcacaatacgtaaagaagtcggagactt
cttgtctaccagacttagtgtcttacgacacgtatgtgatgtgatggctgaaagccaaggcaggcagaaaaaatatgcagacggaaaaaggaagaagaaa
tgttatAAACATCAAAGCGGTAGGCAACGCtggagagatgctcggcagagcgCCGATGACAACGGACATTGTTCTCTAACGCTCCAAGAGCATCGcgggt
caccggacggcgatcgaccatgtcgtcatcgcccgccgccgactcttctcgatgagtggcgtccactactaCTTAAAAACACCTCGTGGGTTGACGTCGT
TGATAGAAtagaacccaatatcttgtgaagtggcggggattcCCAAACTCAGACAACTCTTGGGAGTTTTGAGATGCCACTTCATGTCGTGGACGTCTAT
GATCAAATGGATCATGCCGTTTTGCGTCGTCCTTCGCCCCGCGCTGTTTGGCAAACTTCAGATCAAAGATGgtgttctacgcgcacgttcactttcttgt
ggctttgctgtaaggtagacaagCGAGGAATGTTTTAGGTGCCGCTGCTGCCatcgctcgatgagcccatCGTTCCTGTAGCTGTTTAGCCAGGAGATAA
GTGCGCTGCAACTAACGTTACGTATCGAATTCGTCGTCCACTAATACACAGGAACTTGACCCTTCGTGACAATCAGACGAGATCGAAGGGGGCTGCCAAA
AAGTATTCGTTCTCTGCTCCCACAGAACGGACATATGTAAGCTCCATGAACTCGGCGGCTAAGGAATCTCTCACTTCCTCATCTGCACGTCTGTTGTCCA
TCGCAACTGGTAAGCTGAGAGATCTTAAACGTCGAGCACCATTTCCGGCTTTAACGGCACGATTTACTCCGTAATCAATGTGACACCGACCACTTCCTTG
AAGCCTGAAGAATAAACACAAGGGACCAATACAGGTAAAAAGGGTGAGTCTCAAGCAACGATTAAATATAAAGTATGCACGCTTATGATATGCTTACTGC
AGCCACGGTCCGATGCAAATGCGAGATTCCAAAAGGGTCTTGTTACGGAAATTCATGGTGAGCTGCGCTTTCTTCGGTACCCTTATCAACTGCTGTTGAG
AGATCAAAATATACCTCTTGCTGCGGGAAGTGATTTAAGCGGGACGCTTCAGATTTAGGATGGCGTAGGGACTAGCCTCCTCACTATCTGGCGGCGCAAC
ATTACAGAACTCATCGTAGCTATGTAAAGATCTATAACAATTTTGTATTCGTGCAAAGGTTGATAGCCGAATGTGAAGAGTTGAATTAAAATTTTGTGGg
aagtgctcgagtgtatgcgctcaAAAAAACTATTTTCTGGCAGAGACAAGTGTACCTTAGAGACCAACATCTTTTTTAGTTTTATTGGAAAGCAAGACCT
ATGGTAGCTCCCATTATCGTGCATTGTCTACTACATCTGCCCTAAAAATATTTCAGGAAGTGTTTCGTCCCCAACCAACGTCTTGACTAAGTACGAGACA
CGATGCCGATATGACACGACAATCACGAAGTGCTGAGGTGCAACGATAGAGGCGGTTCTTGAAGCTTTGGAAGAGGGATCATGCATGTCACAGTTTTTAC
TATTTCAGAACATGATTGACAAGTATGTCTATTGTGATTTCTTAACCTTTTCCATAGGCTGCATTTTACTCCTAGCAGATAGCGATAGGAGTGAATGCGG
TATCGCGTTTGTTTCTCATAGATGTAGTGGTATTGGAAAACTACTCTGCTTATGTCAATGCGGTACTTGCATCAATACATGTCAGATTAAGAGTACACTA
TCTTGACCCCAAGTCGTTTATGATCTATAAAAATCAGGCGTTGTAGGGCGCAGCGACATATCCCAACATTAATGTCAAGATGGATAAATGTTCTTTGCCG
AGTCTATCTTTAGGTAAGAATAAGAACGGCCGGCTTTTAAATGGCACTCGCGCTTTTTGTTGCCATGATCAAAAATGGTCGAATAGAATAATGGTTACGT
CGCAAAATAAATCTGTTATTACAAAAGCGTACGTGCAGATGCAGTATGTGTTAAGTTGAAGTAGGAATTACGATGCGAGGAGTTTGGGAGCTTAGATTTG
TTTAAGTGCTACGGTACTTCGCATGTCAACACCGTTTTCCCTATCCCACTGCACGCTGATATACAGCACAGAACAATATAATATTTACTGCAAGTAGTCC
CAAACGATGAAGACATCACGTACAAGATACAAAGAACAAGCTGTCAACGCGTCAAATTCATATCGCATGCATAGTGTTAGCGTTCCGGTATTCAAAAGGT
AATATCGTCATAGTGGTATTTTATGGACGACTGAGCAAATGGttcatctcgctgctgtcgACGATACTTTGACCAATAACGATATAATCTAAGCAGCTTC
TACACAAAGTATTTTGCCGATTTGACTTGCGAGTAGCCATTATAGCGAAAGCGTCGTGCATTACAGTTTTTCCATGCATTTGAGAATATTTTAGAATAAA
TAAAAAGGCTTGTTAATTACCAAAAAGTTTTAAACTAATGTATAGACAATATAATCAAATAGAGGGGCGAGGATATCCTCTAAATTAATTGTGCAAAGAT
ATCGCGCTGCTGGAGCTAGGGCGTCCCACCCATTAAATCTGCATCGGATACCACGGCACATGACGTTTTAAGCTTCACCGAATTCTACATGTGTGGTTTG
AAAGCAACGAGGCTATTGACGCCACTAAGGCCGCTAAAAGTGTCTTCTGCCTTGACTGTAGAAGGGCTATAGATCAAAGTCGACCTGCTGCTATCCGATT
GGCCACACTTTGAAGCAGAAATAGCGATTTAAACTCATAAAATTGAACTTCATGAGCGGGTCCTAACGCCATAGCTGAGAATCAGCATGTGATTAAGCAA
CATGTTAATGTGAGATGCAGGCAAAACACACACGAATATATAATATGAAATCTTTAATTAAATCAAGTGAGCTCACCGAGTTTTGCAGCGTctttatcta
aaaccttaaaaAGGAACACGTGAAAATTGAACAGAAATCAGTCATGGCAAAAGTATAATGAGCTTAACTCATAGTATTTTTGAGAAATACTAACCCATCT
GTGTTCTATGTGATGCCATAACGCAGACACGCTCCGCGCTTACGAGCGTGTCGGGTGTGAAAATCAATATGGTAGATTGTGAGGTGCCCCAGCATTATCT
AATAATTAGCTACAATCTACCATAAGGCAACAGTGGCGCAGTTCTAAAGCGCCGGGATGCCTCGAATTAAACAGTGCTATAGCAACGTTTAAAAGATCGT
CTCCGAAACTTCAC