Description :
Non Conding Region
Location :
contig_1:1- 431
Sequence
430 bases(100 bases per row)
GATCCGGATTCCTGGTCCAACACAGCGTCCAAATCTTCACAATTAACAGTGAAGCCAGGAAGAATGGTACCACCATCAAGATCTCTCCACGCGCTATTGC
CAACGCGTCGAACAAGACAATTTCCTCGGGCGCATCGCTTGTATTCGCACATGATTTTGTTCTTTGGATCAATGAGCCATCCCAATTGCACACCGTGAGG
AAGTACTCGTGCCGCATCTTGTGATCGAGAGCACCAAGCTTGGAATGTGACCAGTGAGAGTGTCGATTTCCACCACGAACGTCGGAGCAAAAGGTTCTCC
ACCACGAGTCCATCGTTGAGCTTCGGTCAGCTGCCTTGCATCATCTCGAGGCACATACGCCACATCGGGGACCCGAAGCGTTGTGCCATCCAGCACGTAT
TCATCTAGCGCATTTGTCACTCTTCCACCA