Description :
Non Conding Region
Location :
Scaffold_1:1- 4224
Sequence
4223 bases(100 bases per row)
GAGGAAGACTTGGGAGGAACTTGGAAAAAATGCAACTGAATTGAAATGAGCTTATGGTTCCTGACACTACATATGAAACACCACTAGGGCTCCTACAGGT
TTTACAACTAAAACCTACACATGCAGAAATAAAACCTATGAATCTGATATATAAAACCTTGGGTACACTGAGGTTGAACCTAGGGGATCTGCTGGGAACT
TGAACTTGAAGCACCGCGGAGATTCCCTGCAAAGTGATTGGCGGAAGCCACTCACTTCAGATGGTAGAGACACGTTGGCCTCGTCACCAGTGTGGTTTTC
CAAAGTAGGAACCATCATTCACATGTCTAGAGTACTGTCGTGCGTAATCACGCCGAATCTCAATGATTGCGAGCGATCAACACTCAACTCAGACACAGAT
TGCTCTGACATCAGACGATGACGTCACCTGTGCATGTGGGACCACTTTTATGTGTTTCACCCAATATCTTCGCACCCACAATGCACTTCCACAAGGTGGC
GTGTGACACACACAAAGAGCCACCTTGCATGTAATGGCAGCCTTAGCCCATTACATCTTCTATCCCTCCAAGACGGGAGATCGCTTCCTCTAAGCACAAG
CGTGTGTGCCGTGTATTGGGGACTGTTTGGAACAGCGTCCCATTACATTTGTGTACTGGCTCATCGAGACCACTGATGCCAGGTTATAATGAGTCACTGT
AACAGGATTACCTGTTACACGGCGTACACATGCTTTGAGGAAGCGCGCGGGAGGAAAGGGCACAGCGATAACGCTGTGTCCAAGAGGAAGGTTGAAGCTT
TGCAGTAGCGTGTAAAACGAGAAGTGAATTAGAATTTTAAAGTGCTAACATGCAATCGTTCTAACTGAAACCTACGGTATCTCTCATTGGTAGATAGTCG
GATGTCCAGTCCGACTATCATCCAATGGTATTAAATCTTAACGGCTTAGTCCTATTGGCTAATATGCAGTTGACTACGTACAGTGTTCATGCATGACACA
TATTAATGTGTCCTGAACTGTAGGTAGTGGGTGGGTTTGGAAGAGGCGGTAAAGCCCATGTGGGTGTCAACCCGCACTCTCATGACCCGAGAACCCATGT
AATGGGTAGCCCCATTACAGAGAAAGCGATCGTACGATACTCTCCGTGCAAACCATGTCATGCGTCGCGGCTTCACTTGTAAAGGCAGGCGACTCTTCAT
GCATTTGTTTGCGAGCGAATGCCGTTGCTTTTGAAAGTTTGAACAAACCAGCGTCGATTTGAGCGACTCTTTTCAGAATTATTTGAGCGTGAGGTCTGGT
GTTCTAAATCAATCCCTCCAATCTGAGTTCGGTGTGATTTTCAAAATACCACTTTTGCTCGAACACGGCCTAGATTTCTTAGTGTACTAGAAGCTATTAT
AGGGAGGAGCGTCGACGATTTAACAGTAGATCAGAGTCATTTTGTCTGCAGCAAGTCTGAATCTTTGCTGTTCAACTTTGTTTAGCTCTGCAGGTGATCA
TGCATCGTAAATCATTACTACAGCTGTGCCTTAGCCGTCGACGCTAGCCAACCACGCGATGGATTTGAAATGCAACAGCCATTTCATCACACGGGACACT
AGCAACCGAGATGATGTGGCATCGAGCGATCAAGCTACTAAAAGAAGGTACAGCGCAGCCTCTCGAGGACACTCAGCAGAGCCATAGTCCCATAGTTAGG
ACTCTCCAATGATTCCAGGCTTCTTAAACTCTATAGTTTCATAGAATACCTCATATGATGATACTTGTCGACGCTCCCACTCAACACACAAAATTTAGTT
TTCTTGGCGTGATGCGCAAAGGATGCTTTATCCCCTCCATAAATTAATATTTCATATATTTATCCGAGCGAAGAAGAGACACGAGCCTGTAGATTTGCTT
ATTGATCTCTGCCACATTTGATATTCCTATAATAGAACATGAGTTTGTCGTGCGCGCTACAGGACGAAGGGATGGGGAGGCAAGTCGACGAGTCCATGAT
ATCAGAGGTAGTCAAGTCGGATGCGCTCATTTTTTGTGGACGAGTCCACGCCAGGGCTGGATGAGTGTGCTGGTGGCACCTGCAATCAGTGCGCTGTTGC
ACGGTGCGAGAGGTGGTGTTCTCTCGTGAACTCGTGCGATTAGAATCATGCAATCACATACGCTCATGTTCTCACACGAAGAAAAAAGAAAAACAGAAGT
CAACGGGGAAACCGTCATGCAACTAGGTGAAGCGGTACTACTTTGCTGCTGGATGAAGGTTGCTCTGTTGCCCACGTATGTGTGCGCATCAGATTTGGGG
GAACGGGACTACCACAAGAAAAGGTACTTGCTCAGTGGCTCTGTTGGGAAACGGTTGATTGTCCGCATTTCGCCATTGGTGTTTTGTATGTACACTTTTA
CTTTTTGAAGACTGTCTGATGCTACAGACTACTCTGCATATATTTGCTCTTGTCTGATAGGTCCACTATTCGGGGTTCTCTTGTGGGTAATATATCAGTC
AACCTAAGAGAGAGCCCTTTATTTGTATCTGCTTGCATTCATCATGACAAGTGTAGTCGAAAACAATAGTGTGCTGTTTTTGGATTGAGAAGAGCCGACC
AGAATGGGATATCATAGAGAGCACTCGTCTCATTGAGACGAGTAATACCCTCATCCTTCCTGATATCTCTCTCTCAAACGAATGCCCGCTGATATGACAA
CTACATACGAAAACCCGAAGGACATGAGGATATCTCTTGGTGAATTTGCACGAGCTGGAAAGCTTTGGCTGGCAAGAGAAAGTGATACGTTGCTGAGTAA
AATGCGACTTGAGATGCTGGAGCCACACGCGTGTAAGCGCAGGTCGCGCGAGAAAGCACTTATTAGTACGTCCCACTGTCGGAAGGATGGGGCTGCACGC
GGTTGCTGGGTGCCGTTCCGTCGACACGGTCTGAATGGATGAGTGACGAGATTAGATGAACTGAGTGTTTGCGCGATAGATGAAGCAGAGACGCTGCAAC
GCTGCGTGGGACTGGCCCAAAGTCCACTGAAATAGGAGGATAAATCGCGTCACCGACTCAGATAAGAGCTCGTCTGAAAGTCCACTATTCGTGTGCAACG
AGGAATTTCGAAGGAAACGCGCCATACAGAGGTCACGAAGCACCACCGGAGTATGAAGCGTGTGGGGTGCCCCCAGAGAAACCCTCGAGCACATACACAT
ATCCAGATGTATGCAGTGTTCAATTTCCCCTTGAGAGGCAAACAAACACAGCACTCAGAGGGCAGCACCCTCTATTTGTCTGAGGGCTAGGTGTCCTACC
ACTCAGTTGAGCATTTGTAAATGAATTAGTCGGTCTCACTAGTGAGTGCCCTGAAACGTGAGTGGGGTTCATAGGGATTCATCGACCGCGTGTGATGTCG
ACAATGGAATCAGCCCGCGATTTGAAGAGAACCAGAAGGTCCAGCAGCTGCAAGGGAACAAGCGACTTAATGAACCGTGTCGTGTACTCGTGATGCACAC
ATTTCTAACTGTGAGTATCATTTCGATCCTCTACTCTGTTTGCTGACACGTCTGCCTGATTGCTCCGAAACATTGCTCACCGGTTTCTGTCGGCGTTAAA
ACAAGCCGCTTTAATCTCGCGCAGATTGGAGACGTCCCGCACCGCACCACGGGGCAGATGTGTTCCTGATGATGGCCGGGTGACAGGTTTATGGAACCAT
GCGATCAGTATGGATTCGCATCCACAGGCACAAAGGCGCTTGAAACTTATCTCTAACCCGGTACACTGGTTGGGCTCTTCTTGATTTCTGAGCTTTGGAC
CTCGCCATTTTATACATAAGTATGCAACAAGAAACTCCAAATCCGGTGACCTACCTGCCCACCTCAACGCGAGTGCCACTTTCAAATGGTATCTGTCCCT
CGGTTAGACAGAACATTGTGTTCTGACACACACCAAGAAGAGGGACTCTCGCAATCACTGTGTCTTCAAGGTTTCTCCTTCTTACAGACTGACAGCCGTC
AGTCTCATCTGATGCGCACTGGGCCATCGCGCGATCGCTTTTTTTTTCCTCGTCCCTCGCTCACCATCTCACTCGGCCTCTCTCCGTCGCTCAGGCTTGA
GGCCGTGACCCCCGCGCGTCGTGGACGATTCGTTTGCAGCCTCTCGTTCTCGCCTCACTCTTCATTTCACGCGCTCCAGCACAAGTCGTTCAAGTCGCTC
GCTCGCCGGAGATAGAAAAGCCA