Description :
Non Conding Region
Location :
Scaffold_1:1- 41144
Sequence
41143 bases(100 bases per row)
ccgcgtagcaacaggtatgaccaaagcgcgccggcgttgacgagagctgatttcccgacgctgcttctcgaaagtggtacagcaacgctggccttttaca
aacgaacttgataacactaacggcgcttttaagaattcccccatgtacgaaattgtaaacatgtccttcaaaaccaagttcatcgtgtacgctgcgcagc
catgcatgccagccgcggtatacgctccatgagtatctcccacgacttgcgcatgtttgcggcgttatctatgacggcagcgcacacagcgccttcacca
acaacagattcgacctcacgaatgactttggccaactatgccgccatgaattcacttgtgtgctggtcgtctttggttcgaactgaaggccaaaatatcg
ggcgaataaatggagacaaaaccataaaattcacgacgctttcgctgttgggatccgaccacccatcacaaaccacagcgacatatcgctgcccttccaa
aattcgttttacgttttccaattcatttcgtatgctcgatcaagcaggcaggttgtaaggtcttttcttgtaggtaacgtcgtacctggacgatattttg
tcagtatgtagcgcatgtgctcattgtcaatgacccggaaagggataccggacgaataaagcgccttggcgacagcgacatgaaactctgctttctcggt
cttgctgattggagcgcagttgctttattagacagagaatctccacgagctctcttcggtgactcgactccagcagcgtcttgtctgtttcgcttctcga
gaaagttagcaaactttgcgcgcacacttgctggtacatttgggcagcgaagaacaatgtgtggcagcaaatttttctttggctgtgcgtgtcgaatttc
cttcgtgcaatgaatacaggaagcgtctgggtgctgctttcctggttgtgactacttaggcacagtgattgtaaattcgctccagattccatgtcgagga
gctctcagattggcattttgcggatggcgagtgagagttggttccgcaacgttgtcgttttggatgtgcatgtgttcgggttagagaagttcgctgaagt
tggagcttgatggcgatttgaactgtactggactaggagaggactcctctctcgtgctcttgataatagatattttggatgtacttcaacaatgacgaat
gtgaacattcctggcacaccaagtttacatcaaatggtattacccctaataccacggtaattgataatacctcggtaagattgatacccaacactattgg
aagtgctacacaaacctgtgcacaagtctgtccatactagcactcagtccaaccaccgacctttccccgacgacgtgtgcctaagttctggcggaaaggc
cctaagatggaacgtatctctatgagaccttgtcttgttacacccatgagcgacggttgacggctcaagaattcccaacaaagacccacaagccccaaga
cgtctgaagtgcctaagggtcgttccgaaccgggatcgtatcggattgtcgcgcgaattccgccgtatcattggccgacgaaacgacacgggatagggct
gtcaacacgtttagcaatggtctctcgatcccacgcctcccctcggggcgccgcgatccgaaccacgttgttgggaattttgagcgcaaaagcgtaaggc
gaaggacgtgatggacgcgttcgaggtgcctttgtggagtgaaggcctaccaagctcgccactgtcgccgagtacagctggccgcattggtggcagccat
agcttcgacacgaggcacttctagtgactccgtgtcgcgcgtcctgctgaaatggggactgcacagaccgacacttctgttagaggacatgctactacat
gagcgctgcatatttcggcaatgtgctgtcgtttgtgagtcctcgtctgctttcacactatgcgctgcctcgcaggcgtatctccgtcgggcttttatga
tgcaatcactgctgaatggacgcgctgtgtgagttacgggcgtcgaacttgagaacgctgcccgcggacgggtcctgcgccaggttctcaacgaccacgc
ccaagacttcaaccttcgacgaccacgtacgcgttaaattacgtgttggccgtgcaagttagcgatcacctcgtattctagttccaacatctggtttctc
aggttttggtgcttcatacgctcctgcgccagcaatccttcggcacctaactcgtcgtcgccattgtcatcttcatgtgcttcttcaggtcgaaaatgta
gcagttggtgcgatcaaatatttctgtcagcatgcccaatcgatgcgagatcctcttatcgtgcagcaacaaagcttggtccttccaagcgacttcttga
gcttccctggtattgtttgctgccgtaattgcgctgacactctccgctagcgtagccaacacctccgcctgtgagctgccccgacgcttacggttgccct
tctttgctctgcttgtgccctttttctgcgagtcgtcttcgccgtccgagtatatgttcgctgagcagaactcgcgatcggcaccccgatgttcgcacca
ctggtgtaagtagaagacgtccgctcttcctccacagtattgccagaagtcggcatcacgttcaccagacttcctcaggaagcagaccgaatgcgcgaag
aaaagttcgtaataggagctctgccgcaaggaaacctcaaaggaaaatgtagccatggcagtgtcgagacctgaatagatcgcaatccgattcggagtcg
ttaaaagcatctcgccaatgcgtcacttaacccccccctttccacgctagccgcgacccgattcgatcccggttcggaacggccctaagtgtcatgcgct
gcgcgccacctaccctaaggacatcgcgtgtatcgagcatggaagctctacccccggaaaatcaccgtctcaagcctggggatcaagcttctgagtctga
gaactagaagtctaagaaatgccactctgaagaccaatgccagagtgaagactgatattgatcccagacctctcacacgatgatcaccccatgttccaag
cctctccagtaagcccaagtatgttccagttgatgtcgaagacttcatgcgtattgagcaaggctctacactctgggaatcaagtcacatgtctgaagat
tatgctacgaagcctgagaatcaccgctctgaagatgaataccagatccagatgattatgtgctagacttgccagacagatcagggacgtccccaccagg
attcgcagaacatagaccggaacctggatcgcagatcttcgaatcactatgacgaccaggatcgtaaacggtgtccacactgtggatctcggaagtgtgg
tgaagtccagaacgctcgagacggcagccgccattgattgatcgagggggatcacgagagatgttatgtgatcagaccttatttgagtctacctgagact
gattcagaccaggtatcaattttcgggtacccatgaagtgatcaagggcagattctgggagggcaccaaaattttagaggtgatcaagagctgaccaata
tgatacagtcattcgagcgcaccgacgtgatcacaaccatgctgatcaatctggtgtaatcatttcgacacatcttccgtggtcaagaacgctgatcaac
ggtggtgcagtcattccagtacgtcgtggtgatcaagaatgctgaccaacaatggagcaatcatttcagcacatcgccaagttgatcaacagtggagcaa
tcatttcggtatacttcctgaccagcattgatcagccgcatgcaccaattaatgggtacatcggccgacgtttaatgtagccagtcagctacgaagggga
tgggcagatgatgggagaaaatggaatggataggaaaggtttaagatggttaacacagaccttgtagcacgcaagtggacttccgaagatttccaaggct
gggaagtattttgacgaaggaatccccaagccactcaagaagaataaacgaaccgacacctggaaagcttgaccaggtctacgcttctctctccaccaac
cctaccgctaacagtaggcccgagcatctacgttggaacctcccattggcccctttggaatagcacaagcccgaaggacaacccccacagctgatacagt
atatttaagtcatgatctactctaccctaccgacgatcaagtgaagaagtatccacaagattgtcaccgattacccctgagtaccgtccacactcccgct
caaccaagacatcaaaaccttcgtctcttctaggtcgcgcaagaagagcgttaaccctgccagaccaacggtacgcaaggtgaaacgatcatcaggccgc
acggccgatcgcagtacctcttccgttagttggcagtccggcccctctgtacccgcgtggtgtcgcttcggagtccgctacaccacaatggtgcgaaaat
tcttgtgattttggatatcaccgtgaatccagtcaaggtgagaccaagaccaaggtcgatccaggaagtagcggcgcgtcgacggaaggtttatcacttg
aagattgaagaatacaccgaacgccagagccctgagaggagctctggcggggacaaggaggaaggttaagcgatggacctgaaagaaaaatctcaccctc
ctcccttgagccatccgggggccaccgcggaccgcgacgcgagtcgtaatccgccggatgaagatccatccgtgaaagcggaagggccttcacccaaaat
caccacccttaccccgcgcccctcgtcgaagtagccgaagaaggcgacgccgaagaccgcgaagatgaagatgatggcacccgacgcggacgagagtgat
gataccaagatgtggacggaagacgagcctctactggaagaaactccaggcgggatttcggctgcatttcgcgtggataaaatggctggcggtcataata
catggaacccaaaataaatgtacggcttttaaaactcggatacattggaggttaagatttggatttttatttgaacggcctcgtttaaacttatcgattc
tacttgtggaatgactataatatataatgtcgtggaagctgtctggacctcgttgcggttgacctcacagatgttcaatttccatatttaacccttctaa
gacgatattctgtacaatacagaataagttagatggcaggatatattatcaattgagcatgtcattaacccaatccaccgcatactacttttgtatagcg
agtttatcattgaagatctatgcagggaagatagtcggggacttctcaaaatgtatttttgaaaaacaatataaaatttatggaggttgaatattctgtg
atgagtcttctaattcgcagaccaccacacgttgccctcgccccacacaattcgttctctccacaatgaacggaccatacgagaagacgctcaagcagct
acgaagcgagctttccaataaggactggaaggcgagtaaaccaaaggggttaagggtggactttacctatcacaggcgtccgcgagctggtacaagatgg
aagaagattctggagatcgtccttcaaggaatgatccaaggtcactgtgatcttgaccttctcctcgattcgtttctcatgcacacgaaagacggcactt
ggtaccctggtcttggagcccgtgtggctcctacttacctggacgctctcacgcttactgatgcttccggtaagttccggttcacagtagcttccagcga
tgacggtagtgatctgaactaggtcgggtaggacaattctctttgatagtggtcttcgagtgtcctccttatatatatgtagggagccctttgggctcca
tcgtcggggacggccccttcatttcacgacactgtttttctacaaatacccacccatctggtatgtgacgttcccacatacctttctttccacattctcc
ctctcgcagcatcccactactgcgaagggtttccttcatcttcctcgcgcgactgcatcgcattaaagcgattgcggttcaccctcttcctctcgaactc
ccgcagaaaggcgccgcagctccttgtagcccttccagtgtaccagaaattcgcggtgcacatggcaataacgggtcctccgacctgatcgaacatcagg
gacccgctccatctcgtatacgtcattgccaagagcggtttcccagctatcctccggcaagagcgcctcgtccaagtcgaagcgctcaatccactagtcg
cgccttcggtcgaacagggaagttcctgatcagcttcagcttggacaagtgcacgatcgggaagacgttgtaatccggaccgacgatctcaagacgagcc
gcgtggttgccgatcaactcagcgacgcggaacggcccgtgccacatgtgccccagtttcttcgcgtagccgatcatcacgcgatcaggtacaaccacaa
atgcgatccagtttcgatatggcgcggacgtacttcttcgttgtggtgatcagctctgtttcaggtggcatcacggaggcgctcgttcacatattcatgt
gctcgctgatagtgttcctgaatgtgatttctccagcgacaagcgtcctgatcgcggtgaccggtgatgccgatcagcaggacggcttccaacgttgatc
gagcgttccagccacgtgcaagatagaacggggtatctccacgtgcgcgatcatgcgccgtgttgagcgcgaaggtgagccgctcggcgtattcgtccca
gtctcgttaatcaacatctgcgatgtacatcttctgcgagcgcgttagtgtctgtaccattcgttcggtagatccattgctctgcgaccagtacgctatg
gtagggctctgtttttgccctacgatccggttgaacgcacggaagggatcagccatgaaacccggctctcggccgtgtcgattcacctcgctggcgccga
accttcggaagacacactcctcgtagttctccgcgatcgtctgggcggtccgagaactactcgccttcgcgatcacgtatccggttaacaaattagcagn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncagcagtccactttcattcagatcatactcactggcgatctt
ggcacagatcttcgcatcttctgctgacaggtttgccacatcgccttgtatttaagccttcatgtgtacaattcacacctcttcgccttgagcttgtacg
attcgttgaaccctcaattgctgcataatcgcctcttgcaggattccgggctgcacttgacgtcgtctaccagctgcgcgggtgacagcagacacgcggg
caacggcgtctttttcctttagccgcagaatatcgtccagatgattgagcgtgatcaggtcctgccgatcagcttccgaggtaactgatctcgcctggct
cttgctgtaggctgtgttggctaacttgcctacgctttaattccattctcttttggcgtgtaggaactcgtgttccggccagacccttagttgatccatg
gctttctgtctcagcaattggagcctgggtgtcttgtagtcggtctcgccacgcttctggcggacgtatgttcgagtcaccgcagatcacgatccgcccc
cggtctgatgtcggaagaatatcgagtccaagcatgaggtcacggtaccccgattcgttgacagtgatcgctggcgtaaatttcgacgccgcagagacga
ctgcccagatcacagcgctgaacgcgccgacattccgcttgacgctcgcggatctatcaacggagacgaccagcgggtcttcatctggctccaccgttgg
tggtggtgtgatgatcagcttgcgtggctgcttcctcggagcgatagtgattaaggtaccgcccatccctgatcgaggcgtgatactagccgcgagggcg
cccaggatctcgccctcgcctgtggaacacttcacaatttctagcgtccatcctgacagcaatgcggccaccttgcccaaccgtccatcacgtcccgata
aattcgacaaccaagccagcgtggagtgtcgagacaagacctcgtatgctggccgatccaccagtgggctaatgtacggcggctcaggttccgcttcctc
ctggtgatcagttggtggcttcgtacgcacgattctaccttttagcatagcgacgcgatcccacggagatgagcccaggcatccgcggtacgaggccttc
aaaccacagtcccagtcgtgtaagcaccaacttcttgtcgctgatgtacgtgattttcaagtactgcgtccgtccaaggcctttcaccaaggtaggcacc
cagctttctccacgggtgatccacaacttctctcgttctaacgctcggggctttcgtatcggtatctctacagattttccgacttccacgtgaacgctgt
cgtcgagcatgatgtcgtgactgctgcgtccatacggagggcgacgatcgatctactggacccgcatttcattcgggaggcacatagtcccgtcggccag
atcaagacggataccggctgggatcatgaagtccatgcctaggatcacatcctgtccggccatgtcgccaacccacgcgtcgaagaagtaaaccaaggaa
ccgacgtgatcttgatcgtggtacgtcctagagttgcgtacacgttctctccgattccgatgcaatcttgtctctgacactcgtcaatgatgcagccaac
cttacgagcaaaggtggtgctaacgatagcgacctcagcgccggtattgagaagcagtgtccctttggagttgttgatcttgccggtggccttcgcctgc
ttgnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnctcttccatcggacatttgccgtcttcgttgatttcgccatgccatacacgtataggcaatgatcagcagggtgaccacggcgaccaggtcaggcgt
ttccagcaaccaagatcagagatcagagtgccttgcagatctgcagcgcgaacactgcggctggtgatcatccatgcgcgacacatcctcacgatcagtg
cgagcttgtggctagctgccctcccaacgactcgagcgctgggcctgctgcttccggcgatcgactgcagcggcaaggtaaacatgcttgatcatattct
gatccgcttgattccagggcggatcccgatctagcgctgtcataagaggcgcgaattgcacgaacggcgcgagtgggcttcgaaacataactgctgctgc
ccctttccgactatccgactccagtgacaacggcaccgaggacgaagtatcaaacccttcacttgtaccagacgctttcgagcgtcgggaagtgagtcgt
cgccaacgatactttaatgtgacattcatcccacctacgtccaacgagtgttaacaattttttgctgtaaagctcgtgttcactgaccaacgcaaacgtc
ttgaacaagaaacgctggaagccctgatgagtttattcattaatcgcggcctatgggatgtgcactctgttaaggatgtacacagagaaatggaaagcta
gagaactaagcaaatggggattaatgctataatgaatttcgctctgttggttttacccattaataaaggaagtccgtagtaccgaacactgataacaatc
gcctctataaagttggtgacctcgtccaatgtgttgcgccgcgtcccagtctgagggaaggaggtaggcaaaatgggacgaaacggtggatatcggtagg
caatatgggacgagacgctcgaaaatgggacgagatcactaactttagagcgacgtcaccggtagagtaaaagtaaaggcaaatgtcacgtcgcttccgt
gtgactatgtaacttgccgattttgcaccggttcacagaaaaactaaagggaaacgatagaagcagtgcaacaaacctactgacctttgactccatcgac
gacaatagacgttcttggccttcgctgcacatacctggagctgtaaaaaagcacgaaggcgctttgacggtttacacacatgctcgagcaagttctagat
cttctgacgcatcgtacttgcgtccgcgagacggaggcattgttgcaagacaaaaaatggcactccatggtgaccgctctgttgttttgactgtttaaat
cgttcttaggccgcagctcattacgatatcattggtcattctatttactatcggccaacgcagaaaaagtatcctgttgtcatatttggctccagggccc
cctcatgttatcccgtaggcatacacactccacgtttcctcagatcggcgcaagtaacctgcagcatattagataaaaaattgataaacacagcaacaat
tatcccttacttatcatgaaatacaaggtatttcttgattaaggggggggggggggtcgaaccttctgaataagctaaaaataaggtagataatattcaa
caatatcaggtgcttttcgccgagaatatgagttgaggacactcagaaaactaggtttatactgcactgaagtatgcacccatggcacgaagggaaggta
ggaaacataggaatcaaaatatttgaagagcaagattccgtacaataatatgatctcttggcattaaactgcatatttgtataccacaacaacactcatc
acttgattacatgggtgacgacttcgtcgtacaaagtgttcttatccttttaacaatattagtagcttatttaacgagtacccccccccccccccccagg
gttacttgctccacccatatgagtaaaaaattggcccccctggaaaaacaaaaaatgcgaccaaataagtcccttggttgcatgggttgactccccccat
ttgaaccttatttcccttttacctagtggaccaaaattattggggtttttaaagggacttggaactacctaaacccttaaaaatagttaggggtagggaa
attaacccccaaaaattaaattataagggatgccggaaaaaggcccccagggatcaagttgaaatgaacttccacgacttaccctccactggacattttg
gaacccgggaatatatgatctccagaaacccaaaataagggtatctccaaaactcttttgtagaaaagatgagaaaaaaacgctggttgccgtggtctca
accaaagaaaggtccgaaatctttcatgatgtttaaaaacctgggagaactgcctttgacccgggccttgccatgcaaggcggccgtaccgtgtgagacg
tttcggaaaaactctgacatttttgggacgcactggtggcgttctggccaatggtgctgcaaacctttcatcgcgtcgcgtacagtacgctttttgactg
cgggcacacctctctagtttcatcagccatcgactcatagcgtgaaaggacgttgcggtaggggcgctgtcgtcgcatctaaggggcatgtagctcatgt
ggtagttcgttagcgcaaaacatagccgagctagcatgtcgtaccgggcctcgctccacttttacgttacgtacatcgacttccacagcgtgcacaccct
gccgaagaagttttctaacaacactcggtctgacgaaacaagtcgattccgtgcaacgtcttagtggctaaactctgtgccgcgaggcttccgctttggt
tggatggttcgagtggtactctcggcgccttggtatcctttattgacaagcacacaccattggagagggtgacgagcagcaccttcgccgcattcttcga
acgctaactcctccgcacccttcttcaataactccatgtgagactccttgcgctactgaaacataatcagatccgacttggatccacgctcgtgggaagg
caagtcaacggggatgcctctaaacactcaagtttgtatccatatagattgtgtttaccgctaaaataaggtttttgttctgcaaattgaccacttggac
ggtacgccggttgaaaatttacatccgttgcatacaaagcatacgggtagttgcgaaatgttctcccattttcacgttgctcagtcacgttcttgacaaa
ctccttgaataaaatgggttcaatcacggcaaaaagcttgtaaattggcttttccaaagtgttcggattcagctggaagccaattgcatgcttgtcccca
cgtgtcgtagtgtttcagtatcaccaagcccatgaacatggcgtccttcgcaattgctttgatcttgcgtccccgtcctatattccatgttgcgcgcagc
tcgccctcttccagtcccctgagcacttcaaactcggcttgagtgaagttaggcatcgttttaagcactatattccctccttgaaagtagagggaatcca
taatggacgactctgattttactacctcctcttcgacgtagtcctacgtagatccgagctactcgctcgcacacactgtgttcgcatagtgaagaataac
tgcgcgccaccggaagtcaggagtcctgactcaggaccgtacatcttggtggatgctggatgaaaagacactggattttaaatcgcgccttttacgagtt
gaaaaacatcatagatgaagtcccattaattgcatttgaccccactttatgttctaatttctggagatttcattgtgcggaatagcatatttattttgtt
actaatctgtcaggagcgttcttgatcgacgaccctgaagatgatgaagccgaagctgatcggcgatcttcaaggcccagtgatcaagccagtcaatccg
gtagatcaagcggcggcgatcagcatgctaaaggaagcggggattttggctgggaacttcaacgccgaggaaccgctcgaacttgaccttcccacacttg
aaggatccaccaaacacttggtgaagctgctcacgccattggtaggcgccgtcgttttgaccgtcgatggggactgacgacgacatagtccgggtcacct
cacttctccttcacgtctgcgaagacattgcgagggtgtcgtaggcgggatccgatatctcgttcgagctaagcaggatgacgcttggaccagccggagc
agccatgttctctgaaatttatttcagagtatatcaacgatcatactttccgctcaaaactccataaactgaaatatcagaaaacaagaataacactcgt
ggctcaaaacagaactctaatatctaataagtcttcaagaaaacccaaacaacccaggaaaatgttgttccaaggttctactgtcgcaataaattaactt
caagttatagactgtagagatatcgatagtatcacaacaaaaagcgaactgcattagttcatatctagcgagaactgaatcaaccaggccctcattgttt
gcacgatattcgttgaaatttacgctcgaattataaattacggtaatgaatcgcgaatcacccactgttcgcgcaacattatgattattcggctgggtga
gtacatgcacccagcgtagaaagaaataatagaaagaaataaaaggataaatacgattctggcaactatcacaagtaaaagtttaaattaacagactaca
acccaagcaatacttggaatcatttatctctttcaatgatagctgcaacatcacttagaggcactcaatacccgttctcatcttcaaaccgaacttcgtg
ataacggtcgtatatttctcttcatcctcatccgccgcggtttgttggtcaatagtagttgcgtgctgagcaacacacacatcagcgagctttgtattga
attgacaggtctcctcgcgaaagacacccaagccggtaaagtgtacaattcgaacgatgtcacccggagaaggaagccctttactttcttcgaccacatc
ccatacggtagccatctttagctctttgttagtatcaaagtggcggtcgccttcgtacttgtagttctatctcacagtatgcaaatttgatactagtgta
atattacctcattaagaataccatacctcaagggtttcggccaatgagtcgtcagcaacagcgtcgtaaagatgcagattaactatatttctacctcttt
cagtggtgtggtcagactcccacaagaataatcagtagatgacgactattatattgggatctttagatgctttggcgtacgtcctgagttctagaaaaca
gaggtgttagtattagtgcttaagtcgtataacatgtcatttaaaccttgatcagttgtaatagctctctccgtcattgccttcactttttcgcgacgtt
tctttgagcgaggaagtgtagccctttgggactgggaggttaagccgcttcatgtccttagatttctttcgtccactgtttttggtagcgccgtttggag
ccatccagtgttcttgccaaagaaaaaatgccaatgccaattgctgccaatcaatccaggaaatgattctatgtctaataggtacgtaccaacatgatta
taggagtagggaataggctcagtatctctcattgaattaaaagataatcgacgtgctaatacaacttgtactatagctcttggattgggttactcgcaat
aagtattacgaaacgcaagcaaccggcagggcgtactttgcgatgtgtgttcaggagatccatgtcgagaagacccggagagagtcgtgcctgaccggct
agagccaatttctcacgaaacaaagtcacgtatttacgctgagtatggtaggcgaatgacgatgcacccggacaaggtgtgctgcgttttgacgcatttc
ttccagctgatactgtggtagacaaaccggtatcacgaaatagctctcttgttcagacgatgagaaagcgattgcagtccccgccaaatctacctccaga
tcttatgaaacactatgatttaactggtatttcgtcccaacttcacggtatcctgatttcacagaccggagttactattgaaagtaaaaaagggattctt
cacctttgtaacgcatgctacgtatcactcgcgaacaagaagctatcatcacccccgaaatttgcaattgcaaatgggctatacattggagtttgccgac
ccaatttgctgacttgacgatgactgagaatgcaatgttaaatcttgctcagccaacccaatttgttacagttgttggtggtggtcgtctttcttcactt
cgatcccatgcgtacttctttcgagctacccctgctcagctccttccggaaccagcggtgcccaagggaaaattggtgtatcaatggtctccatgacgcc
acgccagaaaacagaaacggcaaagcgataccaagttcgtgattcatgtctgggagatcaatatgcgtgtatcgtagaaacaatgttctctaccgcgacg
tgcaactcacttctagtttggaaacggatttcgatgaaagtcatgatcaacacagtgttctgagtgattgtacaactgagagcaacacagaggaatcaac
aatggccaacgggttagttgcagcgcactggcggtttaatgcccccacaccatcgatatttgacgcaaatgatgaagatgaactgtgttcccaaacagca
gttgcactagtcactgactatgccgtcgaagacgccaacacacaggcaccgaacaattccgaaggatacctctgatgtcgtggtctggcgatcatcagag
atattatcagattttactccggcttactggatttacgcgttttgtgaacttttcccctatagtcgtggaggactggatgaaccaagagccgtacgaatcg
gtgttgaagaatatgtgcgccattgtttgcggctatcgcatcaaaaacatgctcatcacccgtcattcatgcttgttgctttcgacatactggcgcgtca
ccacgccatgtgtgccgtttatctacgtgctaaactagcgcctcatgtggcaagcagctccgcaaatgttggtcgctccgagttacttagtcacatggaa
tattgggatgcccgcctaaaagccataaatcaaagagaacgggtaccagatcctccaccatcctctaaagccgtccaagatctattctctggcatttcga
cgggccttagagcccactggggatcgaatgaagaacgtgccgatgctcgaagcaaagttatgtcgctgcagttggaagcggggcagccatccatattctt
tacgttgtcagtagcacatatcaaattgcaaggcttgaggggtgtatgccaaatgaaatgctagcaaaagctcgaatatcgctggatgagtgcctggagt
ttacgcaatcccgcctcagcatgattgcaacagaaaccctacagtttgtgcattcgctttgctttcgacatctagaaattattatcaacttttacaagtt
ctgatcaatttgttttgagatgcacatatactttgatcacctcatgaacatttttattcatgtagttctcaattgggatcaagaaaatcatacttccaag
caggtaataagtcatttgggcggacaagagctttctttgctgcgacagaatatcaaaactcttctggagaattacattatcaggcgctggtctggattga
aggtatgccccgaaccgttgatgagtattatgaatcgtgcgagcgctgggactttcgtaatcgtgttcttgcgtatgttgcatctataacgaaagcaaca
tttcctgctacaaatgatgtttgcccgcaatgtgaggaaagccaactaacgtcaagtgaaatgtgcgaggaagcgtttaaaaaggctcgaagtggggctt
cgagaacgacaacttcaaaatgcgtatcttgccagtctttttcggagcaaatgaggtgattgaaggccaaatggagcgattagcaagtcaaaattctgta
cccgatactgagtggcgctctgaaatggtacgtcggcatttggctcatccacacccctacctcttgttcccccagacggataagaagtagtgtgtttgct
gagagaatcagcagcattactttacttttaaactcattactggtttctacaccgctcttgcttcaagaacactcggcgtacaccgaaagctaatataggc
cggatgttcttcggaaaatcaacatcaccgttgacacgatggctgcgtaatggttcagtggaaacagagcgtcgcgttggatgtgaatatcttaatacct
actctcctatcctggcgaaaacctttaagaacttaaagcttcttacagccggagaaggtaaagaaaaagcgttctatatgctcaagtacacaaccaaaga
acagaacacactgaaaaaaaccctggcaatttgcatgcatgcatttgacaaggctacgtcaaaaaggaccccgtcgaacttggagatcgaagcgggcaga
cgatgcatacaatcaatgcgttgttcactttcaaaaccacaaaaagttgccacaccattggcagcactctttgttattcgtggttccccgttttaaacgt
ctacggaatttgtgaaagtgtttctgtgcgcgtttgtaaaattcatttttactgaggagctctgtgacataatgttgagttgtagtagctcaacaacgac
gtacaagccaacgagcgccgttttggaccatagctatcgacccgctgttcttcagatggtgtctctgatggacttcacaaaaaattggaaaatagagaat
aatgtaactggatatcgtttcctttccaatcatggtcaagtttttactcatagtttacacagaagaaagtttcctgcagtcgcgaccttcattgggaaac
gattcccggatactcgatcggacaacatcgagctcgaggaacaacttacgcttcaacaatctttactggtactgtttaagccgttctgacgacgtgggga
ttttccaaaacacaatctcagcgatttctatatagaatggtggagagatgaagcacctgaaattgcccgtcagttcttacagaacttcaacgattactac
atgtatacgccgcattaattatcgagaaaacggtcagacgccaatatggagcactttagagctatggtggatgaaagtggcaatgacgatgatttctttg
acggtggcagtaacaactgtgcgtaggagcaagctgaagaaacaatttgtgttgatgactcaagtgatgacattccagaagattattgttttggcatcgc
ctactacaaaaaatatcacttctagagttagggggaaagtcatcggagcttgcagcaagctcgagctgtctcacttttgagcatgtcaatctgacgatac
cacacctttctgactatgaatggaggtcacgaatttcaatggctgaaaaaaaaccagcattgccaacactgaatgacgagagactcgtgcaatgctctga
caatcccactcgtgtacgagtagtttttaatagtggtgagaatgacgagctttcctgttgacaccgcaactattggaaatacattactccatgcaaacgc
gtcactccgagaagtgtcgggtttctttcaactaaaccgtaagcaacacaaaatgtttgttcgggctggctcaagattattgcagtcattgacagcagca
agttgtggcaatgttgaacgaatgattgggtttttaggcggttatccaagtacaggtaaaagcctagtaattaaagccctccaagcacttgcaaacgctt
agggaaagctcggatgcaattgaaacagttgcgtatcggggtattgctgcgaaggctgccaatggacagacaatccataaacgttttcaatggaagataa
acacgaactggcgtcgaagcgatacactattcaacagcgagagcaatttgcgcggtaaaagatgcttattatggataaagcatcgactacaggtgctaaa
tttatcggaatgatggcccaagcactatgtgacttaaaacagaaaccgggtgtattttttggtggaattcacgtactatttgtgggcaattggcttcaac
aactccctgttgctggtgtcccggcatttgtcgaccatcccccactgcctacgtctaacctgacttcacgaaacatcactgccacctatttcgcgagaat
acgcggaattcaggcttactaacagataaacgaagtagtgttccttgaggaaaacatgagacatcgagcagatccaaaatgggccgaaatactcgagaga
tggagatatgggaattacactgaagacgacatcgattatgtgaagaaccaatgctacgatgacaactggaagtcgtctgcagtggatactaagtcgttgt
gtccgattatcgtcacttcgaacactcttcgttgtgaatttaatggtcaatcggcagaatgtttttgttgtcgacagtccaaaatcttgcctcagttacc
tgccaatattccgaagtctcgtttccagatatcttgatccaacagaatagtttaaagaatatccgtgacgacaaaactggcaatatggccattgtgctga
atcttgcagttgggatgccccagtgcgctcaaaatgtgactcaatctctggagcaagcgaatggtacaatgggtcacgttactaatatccaacataacca
atatgacacgactcgattgacgacgcgaaagattaaaattgacggtcaagacttcaacttaagtgtgtgtcttcacacgaaccccctccccccgcgatcg
tcttcattcgactgctggaatacggcaaatcgcgatcaatagtgggcggacttgcacccggaattgtacccgttgaaaaaactaggatatccattactct
accatttaccattaaaataagtacctgttgtcccagcattttcgctaacgtcaggaaagtgctaaggtctcaccgttcagaagctaattcttggtccaat
gcgtcaccacacacgacatcagccacaacgttcctcgttttacatggcagtgacacgagtaaggacactctctcaaatgtttcttgcagaacggcttact
ttcgataatttacgctactttgttccaagccacgctgtttgaaagaaacgcaacgactcaagaatctagaacacaattgtgacgaagggcatcgcctccg
gtctagccagtaacactgcaatgcatacatcggaacataaaatggtaatgatcacttacgataattaccttattatacaattcgtataactagtacaagc
aaattgacgttcttgggagttatcatggcgcactagttagatctgtcataccgtttattcactacatgtaataatgttacataaatttcgagctcgcccg
cgcacgcgcggcttagttagaaggaagctacgctgaaggagttctccggcaaatacttcgacgaagagaaggctagaagctggctgagcaaggtgggatc
cacgttcgccagcgaccaagcggctagttggcccagcacgaaactggtaccaacagttagggaggaccacccgtagcaagtggaatgatctgctgggcga
cttccgagtcgagcacttgctaggcggcttccgagtcgagtattgtgtcactcacaaggaagcgatcggacgggaagccgctggagtaccttcacaggct
cacagtaccgggcctgcccgcgaagttggaaatcaagaccggcttgacatccgcgaagcgcgaacatgccgaacacttcatccaaaccttgggtgatcgc
gagttggctgatcagctgactctgttgcgtatcgccgatggagactcccttgccgatatactcgtgcacatcagcgtgccagggctcgccaaagcaaagc
tgtcgctgggtcgaacaagttccggcagaaggcaccaagcggcccaccgcaagctgcctcgaagaccactcgcgccgtccgcgccatccgagcctcatat
gacaatgccgggtcgggatctgaactggaatcaagtggatcagaggatgaccgaaccccgtaatcgcctgacacctgacagcgtgagagtactgcgttgt
agagcttgtgtcaccccttccatcttttccatagtgtcccggagggcgaaaactatctcgttttcactgcgcgtcaacataagctcgtcgagggcgtact
cggtaatagatccgtggtcaagagatcgtaggactggctctaaccggcaataacgattgaccatttcataggaacttgaccagcgcgtatcgttccgcgc
gacagggtcgatatgcgtttttttttgcgcaacattgcctgacacttcaacttggacagcacttttatgagcgaatgaacctggctcagcacagtctcct
caggggccagcatatccttcattgccaagttgaacctgtgactagcacagccaatgaaggggatggctccttcacgtcgtccaatgtactgatttacaga
acagttgtccccgatcatgcatcccaaggtctctcataactggacgtagtgtcggcaattaggtcaaataaactttgagcgctgagatcttcttcctcgc
cgactggcgaaaacacaaggggtagaaaccggcgcgacagacagtccagatcatcaaagtagtcttacctagtgaccactagcagaagtgtcatcaaaga
ccgcaaaaatagcgacgtagtgccgccctgcgcttgtcccatccgtccataatcagcgcaaacttgtccgggagattagtgcgaacacggccttgcacgt
ggttgtccagcttagtcacgtaggctgccagcgtcttggcggagatgttgcccatcttgactttttggcgggtgtgaccgcgctcgcaaaatgtaaaggg
caagcgctcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnagtgagcggggaaaatctcagctggtggttttgaatgggaagaaaaactcggacgactatgtgtacacgttgtccgagtttttgc
ttccctatgcacatgccaactacggtctagactatatcttccaacaagataatgccagcatccacacctcagcccgcactaaggacttttttgcggacca
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
tacaggaacggtaagcaattcgacaaggtgtgtgatctgaaagaagccctattcgaagcttggaattccatccctctcgctttgctgcagtcactggtag
agttaatgccgcgtcgctgcttagcagttgttgtcgagaaaggagatagaacgaaaaatatacttgtatttttgtatagtctgtactgtccgatctggtc
tgtcgtggagctgaaagtagaaaattgtattggaggtcccccacagcggccgaatctgctctcgttagcgctactaggcttttcctactgtcaacaactc
gcatatatctaaatagcattgcctaattcgcagtattgaccgcgttagagcactgtaagtgggtgtccgatgtgatctgtcgtgcagtgtatttttttta
ccgaggtctgattgctataatggttaatagcaggttctgcttgctcatgccaggtattgtgaattctgtctatatttgacgatgtggccctattgaacca
accgctcaatacaaagtcaattgaccattcgactcactcatttaagtacgaaaagaggaatcgtattaaacgaattcgaatcgaattgactgtatgctat
atagtaaaatctagtgcgggttcgatgggagattgggctggagagattgaccaatcacccaatccaatttggagtaaaacgcacaatatttcaccatatc
gcaatggtttcgacgtcccaacaattcccggcaggcgggaaaaggatacaaccgaacaaaaactattaaacaacataacgcatacgtatgaattgctcag
ctaggttcgatgcaaccattggctgaagtgagttgagtcagatttcatgcggcgatcacagccgcgaggatttcgcctctagaggcctgtaggtcgagaa
aatgggattttcctgtttacatgcaaattgcctaggagtagtgcgcgcgatgagggcgcaaaatcattaatgaggggtcgatctcggcaaggggctacta
tagagcagtattnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnagccacacgttatgcattgaagtaggatttacttggttttactatgttagatagttaaacacatacattaccccctaggcgg
ctagccgcaataaaagataaataaacagtttggttttggaacactaagagtaaagtcctttattaaggtcgtagttagtaggtgcctttggtaataaagg
tctattaacccttaataaggtgagtgttaatccttaactcgttgagttaaccgtcttcctctgacgctaagctacggcagccccgctgcacagaaggtgg
cgctggcaacatttttgcacccatccaagaagcagtcgataacacacccgcacttgtcaaactccccaatgtcaggaaacgtaactccattggctctgca
caacgtcactcgttcaacactcgatgggaactccaaatctccttgcggaaggacagtctcctgagaaggtgtctctggaagagatgtacgtctagcgtgg
aggttacgcagacgacttttcacctctggcgaccgcaaaatgtcctggatacgtgtggccttcacagtctttgcgtggtgaatctggtcaccactacacg
taactcacatttcaattggtcgcgacgtttgcgggagcggggcacgtgccactgcgcacgtcggttcttcggttggtggcggatcttggcgcggtcgtag
tggctcgggatctttttcaagtatgctgcagcctgctcagtcgtaggcatagtagatacattgtccccttcctcctcagacgaaacgagattgataatct
ggataatagacggcctttcatctttcccctcacatgctgcgactttatcggtggtgttcggtagtgaagctgctgttgccttctcctccacgtcgttttt
gcagctactgggaggggtcataggaaccgaatctagctctgagctctggtaatccgacagtggactctcagaaacaatatcctcgcggatatcctttacg
cctggtgaaccgcttctactgcgccgtcgactgcactctgtagagctttcttgagtatgctggaccgcgaagggatcggcactgacccacgaattaactt
gtaggagcgtagcttgccacaccaaggcaggcggagcgactggcgttccagaggcgtccaagagtctctttgtcatcatctctagcgggattggctccca
agtatcgacgcggatcgggaactcgacgtctggagtggtgtcgacgtcagtgacaaccgcaatacgttgccctctggggtccccggcaacgaatgctcga
gtataatacgctagtgtctcaccagcctcatgcgtctgcggtagtagctcagaagcactgatctgcaccatccttcgcgtgtgcgtgctggacgcgtcgc
cggtggtgctcagtgcggctgcctgcaggacgatctaagagtgaatgtattaataccagtgctttgacacgctacattctacgcaccttcacgcaacatc
tacgatgtgatgccgcagcgtcacgactggcctgtcagacctacccctgccggcagcacagcagaagcaaatcctaaaacctgcactgtccgtgcgtatt
gtgggagatgggttgttgtgttaccggcatttacttgtcataagggcaccccaaatgcacgtgtgattagggtacgacaagatttgaatggattgtcaaa
caatcaaaaatgctcgtacttaaaaggatgtcaactgtatcatatgtaccagcaccttttgcgtcaaatccattctcgacagagtggactcccagacagc
gctggagcgacggctgcgctgcagcccccacgctacgtggggcggcgtgcattgacagggagctacctgggtacgtgtggtcagtgctgcgtgcttctcg
tggtgctgctgtgtgtctaatattgtttgtgtgctgtcactgtttgttggctttaagatgtatgaggcggcgctggagcgatggctgcagcgcattgaca
gggagctagctgccgctgcgtgcttctcgtggtgctgctctgtgtgtaatatttcccttttgaacacatgcattcgatgccttgacgttctctaatccac
cttcgaacaagtttttttttcctttttttcgctcacaagtgtcaatctctttatcaaaacatgcatcaatagttttatcaatatcaccaaatgcatcaaa
gagcttgatcgcccgtaacatatctgagtaagggtacgctgtccgagcataaggtttcggctttcgtccggttcctcctagtcgtggtcgacccatctgg
agcgaaatgaagtctgaagtcttggaaccagccatactcctttcgtacataaatcatttggtactgtaataggtgcccttatgacaaaacatcccatgta
ctatccaaagatggaaaaaccctaaaacacctccctgttggcgcctagggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnccatggcgcgcgcggggaaatcgattgtagaggtgcgaactggaaaacag
tccctgtgaaaatcgattgtaaaaggcgcgatttgagaatcaggggttggctggtttagggttcggttttaagttgctgttgagttgttataaagttgct
gagaagttgctttggttattttatatttaaaaccacactggtcatttccataatgctatcttgacactacgatctcaaaccggcaatcgaagccgacaac
ttatatcgctgctagggtgtctgtaattagcatggcccgccaggctcaggtcaaccgtttcgggcggaatttgcttcagcttctgtgcacttttgcaaca
acgtcttgtttgattgtttgattattttgccgagcttttagaagcattacaaccttggacggtttcggcatacaggtggatcgactttaaagtggccgag
aacacttcatactctttgtgctctcgaatcgactctaatgtacgtactatagctttgaaaaaattagtactaaaatataacgcctttgatagaagttcta
gttccagtcaagagtccagtccagtggagtctctcccttttttccacttttttaacttgatttttgtatttgagaaatattattaaacctggatttttgt
atcccaagccctatcatccttgaactgactccatgtgcttatatgcacaccactaccttgtagttaatactggcaggcatattactttgtcgtttgtgca
gggcaacttgcattaggtgcgttgtcgttcatgtgcagggcaacttgcattaggtgcgttgctttgtcgttcatgtgcagggccaaatcgaattcgtgcc
agcggcttggcgacagtcgggagtttttatcacgtttataaaccctgttatctcttttcttttgatcatgtattataaataacagtttccacgcttctct
acgtctctttgaagctggggaaagtcggagaaaaggagcgacc