Description :
Non Conding Region
Location :
Scaffold_1:1- 41
Sequence
40 bases(100 bases per row)
GGGGGTATCCTGGCCTCATTCTCCATTGCTCTGTGCAGCA