Description :
Non Conding Region
Location :
Scaffold_1:1- 2020
Sequence
2019 bases(100 bases per row)
ATGCGTTACGAGCAATAAACATCACGCGCTCGCCCCCCAAATGGCTGAACCTTGTGCTGTCCATATCATTTTGTCTGTAACGGGGTCACCATACACACCG
CGCTAGTCGTACCTAGCGCGGTTTCCTCCCATTGGTCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCTAAGAAGTTAAATTGAGCTGCGATTTCACCACG
AAAGTGTTCTAATAACGTTCTCTAACATGCTAAAAAAAGCTCATCCGCAAACACAAAACTCGAAAAAAAAATCACATAATTCAATTTTACTTTTGCTGTC
CTTAACATTTTGACGTGCACTGTACTAGCGGTACGAATCAGCAATGATATATTATTTATATATGCTTGTCTATGATGTTCGAGTTCTCTTCGCTGTGATA
TTAGTATATTGTGAGCCAAGCGACATAACAAATTGTGAAGAGGGTCACTTCACGCCATGTCTGAAGCTTCCAGTGAAATGTAGGTCATGACGCGTTGGCA
CCAATTGTGATCTTCCAGGTGCTCAAAGGTATTGATTTACATTTGCAGAGCAACTCCAAGCGTCTGTCCAATTATCCAGATTTGCCTCACCTCAGCGCGT
GCTCGCACTTTGAAGACGCGCGAACCAATACCAATCATTTCATTAGTAGCGAGACTTCGTGCGACCAAGATGAACTGAAGCAAATTGTGGGTGGGGTTCA
AGACTTCAACGACGATCAGCACAAGGTTTTTGAAGAAGTGATGGGAGCAGTTAACATATAGACAAGTCCGAACCGGCTTTTCTCCATAAATGCTGTTTGG
CTAAGAGAAAGAGCCACGCTAAGATTCCCTACCCCATGATCGTCGAAGTTTAAGATAGTCAGAACCCTGTGAGTGGGTTGATTGAGCACATTTACGGCGG
CATCCACGACAGACATGTAGGACCCGGTTATTTCTCCAACAGAGCTATTCTGATATCAATCAACGTAGATGTCTAAGCCAATACCAAGCAGTTCTCGAGT
CACTCCCAGGAGATCCAGTCGAGTACCTTTTGATAGACTTCGTCGATAAACATAACCGAGCCCAGCGCAATCTCTATCCGGTGGAGTTCCTCGACACGCT
CACTGTATCAGGCATGTATCCGCACAAACTACAGCTCAAGATCGGGAATCCGGTCATGCTACTTCGCAACATCAACGGTGAGCAAGGTCTCTGCAATGGA
ACGCATCGCCAAGTTCGCAGCTTCTCCGCAATTGCATCGTCGCGAAAATCATCACCGGGGAGATTTCTGGTAACCGAGTGATGATCCAGCGCATTTTACT
GACAACAAATGAATTGATGCCGCCGTTCCAACTTCGCAGGTGTCAATTTTCGGTCCAAGTATCTTTTGCGGTGACGATCAACAAGGTCCAAAAACAGTCG
GTACACCATCTCGGTGTGTCCCTTCCGCAGGCTGTCTTCTCGCATGGGCAGTTCTACGTCGCGCTTTCTCAAGAGACCTTCAAGATTCTCAACGACCACA
GCGCCCTCAAAGAAGAGGACCGCATATGCATCCAGAGCGTCGTGTGTCCGTATGTACTTCATTAAGGTCGCGCGAGCATAGGTCCGAATGTGCTGCTTTC
AAGTTGTGATTTTTTTGCCTTTTATCTGCATCAATTTTCACTTTCAGTTTTTCTATTTGGTATCTATCGGTTACTTGACTTATGTGTTGACCACAACAAC
CTTGTTAAATGATAAAAATGTAACTCGTCAGCTTGGTAACGAATAGAAGTCCGATTCGATATACTTACGACAACACATCCGGATAGACGTCCACTATTTT
TTTGAAATTTTACCCCGCGCAAAAATCAAAAGTTTTAGCGCGCAAAAAAGTCTTTGAATCAACGGCCATCAAACAAAACAGATAAACAAGCACGAAAAGA
AAAGAGAACACAAAGAAGA