Description :
Non Conding Region
Location :
Scaffold_1:1- 15493
Sequence
15492 bases(100 bases per row)
GGCATTGGCACTTGGCAGCAGTGTATCTACGATGGGCGTCACCACTGTCGCCGTGTACCGTAGTTCGGACCGTCACTATGGGGCTTGCATGGGTCAATGT
AACTGTGGAGACGATGCCGAAGCCGCTACAGCACTTACATTTGGTAGCAATACTGGAGTAAATCTAAGTACCGTATGTTACCGTTGAACGCTTTGAGTAC
TCGTACTATTCATGACTCTGTGTAATTACACTGTATTCATCCCGCACTCGATATCCGATGCATTTTGCACGGTACCTTGTCAGCACAGCTACGCTGCATT
CCGCATGGCGGGCATTGAACCTGCACCGGTGGGTTCAAACTCCACCATACTAACATCACATACAACGATGAGTCGAACCACCCCATACAAAGCCTAGTAC
GTTCGGTCCCTTTGAACACTTCGAACATGGTCATACAAATAACAATATATTCGGTCCATCATATCCACCCAACAACGCTGATCTCTAGTACTTCATCATT
CTAGATTCTGCGCTCAAGTGGAAAGATGGTTGATCGCAGGAAGGGCGCGGATAATGTAGAGGTACGTGTTTTGGCTGTTTCGGCATCGTGTTGTCATGCT
AGTGCTAATACGAACGGCTATGTATGGGTAGTTGCCAGGACCAACGAAGACGCATGCAAGCGATGGAAGGCGAATTTACAGATCGTCCAAGACGCTTGAA
ATGGTAGTGATGACATTGTTTCGGCCGTGCTGATGCTCATCGCATATATAGTCTTTGGCTTTGTGTAGCGCCGGTGAGCAACTGGAGTTCGACAATCTGT
ATCCAGTATTTGTGACCCCTTCTGGGCGAGAGCGGGTAAGTTCGTGTAGCTACGCAATAACGTTTGGCTAAAGCTAATCAGTGCCTACCTGTAGAGAACC
GAAGCGAGATGTGGCACGTCGATCGACATAGACGACTTCATAATTGCACTGCCAGTGAAAGAGATGAACGACCTCTACGTGGCGATTTGTCGCGGTGAAG
ATGACCGTGCGCACAACTTTATCTGGGTGATGCGTTGGCAGGAGACGTGCATGGAGCTGTCTGAGGTAAGCCAAAATGTGTATCGTGGCTGGTTACGGGT
AATGATATCTATGTTTGTATTCGATATGAAAATGTAGATCACGCGCCCGCAAATTCGGGCACGTCTAAAATGTATAAACTCCAACTTGTTGCGGTATCGC
GAGGAGCAAGACGAACATATCGAGCGCTTTATCGCGATGGAGGCGGACCCTTCCACACCACACGACACCCTCATGAACCATTATAAGGAAGGCCTTGACT
TGCAGAAACGCTACAACATAGTTGCCGATCTAGCCACAGCTATGGACAGAGTCGATATGCTGGCGGACCAACTCAANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCCTATTTGTATATCTTTCTAGATTTGACAAGTGTTCAATTCAATAGTATGCGGTATACAAATTGGCGTTTTCCGTTAGCTACC
GTTTTTGCCATCGGTGCAGTGTCTAGGAATCGAAGCACACACAGCTTGAACTCGTACGTACTTAAGTAATCGCAACGAGCGCTCGTACTGCTTTGGCCGC
GCGTCACCTTCACTTTTTAAGCGCGTTCTACCTGTTCGCGCCATTCAAAATGGCGTAACGCAACGAGCGCGGCTATCAGGCTCCGAGATTGAATGTCTTA
TTTCAAGTGTGAATTATATGGCTTTCATTGGATAATCGAAAGTGTGCTCTATGATATATATGTGCTCTATGATATTGTGCTTTGCAACCGGTTTTCCCTC
CTAATTAGTGCACTAGATAGTGTTCGTACTTAGTAGTGGCTTTGAAGTCGTGTTTCGAAGCCAGCTTGGCTCGGAAATGGCACTTTCGGAAAGTGCCAAA
AGGATGCTAATCCATGCTGGATGTGCTAAATCATGCAGGAGATGACATACGCGCGAGGAATTAAGTTTCAAGTAGATTGAAGCCTTTTTGTAAAAGTCTA
AGTAGGTGAATGCATCAATTTGCAAGTAGATTGCAACAGTCGAAAATAACGTTTTATCATATCCGAATTGAACGTTAATTTTATGGGCAAAAATAACTGT
TTTCCAGGGCCAAGTAATATCGTACGAAATTACCTTTTTAGAGTAAGAGTGTCGTAATGCTAATGTGTAAGTTTACATCATCGCTTCGTAGAATTGTATG
CACGCAGACCAAACTAACGCACTTGGTTCTGTATTAAAACTTCGTCGGCCGCGCGTCTGATAAGTACAGTTGGGTTTGTTGAAAAGTCTGAAAGCAACAA
CCTACGACTCGTAAGTTTTAAAACGGACGGGCATTCTGAGCAGGCCACGCCTCTGTTAAGTACTCTTACGTTTATTGTAACGTACGACAGCAATAACTTA
CGACTCGTAAGTTTTAAAACGGACGGGCATTCCGAGCATCTCACTTCGCGGTATTCTGAGCTTCTTGTCGTACATTTTGAAACGAACGTTCATACTTTTT
TTCAGTATCTTGGGCCGGAGATTAGCAGCACATCTCTGTAGGAGTTTCATAACCACCTCGTTTAGCCCGTGTTCTCTTAGCTCGCGAGTTTTCACTGCAG
GGCTCATTCGTCTTTTTGTCGGATACCCACCCAACTACACGTCTAAACACCTCTACCACCTCTCCTGTTTCGGTCACCCGGACAATGTCTTCGCCCATGA
TCACCTCATCCGCTGTCGAAGAAGCGGACATCGCCGAAGTCATCGAGATGCGCATGCTACGACCTGAGCTAGATGTCGGCTGGATCCCCTCGACCCCTCT
TCTTACGGCGTAGTTTCCAACCATGGGAACAACGTTGCGTCTGCGACGCTTGAGTCGAAAAAGGCTCTGCTGCAACGCTGTCGCGAGTTTGCTCGAGCCC
GTGGCTTTTCCATTCGCGTGGCCAACAACAGCTATCACTCTCGTCGTCAAGAAGGAAACGCTAAGTACACTTGCAAGGCGGTGAAAGGGCAGCAGCAGCT
CATTCCAGGCAGCACTGCCAACTGCCCATTTTTCATTACGGTGTACGGGATCCGCAACAACTGGAAGATAACAAGGATGTGTCTGGCCCATGACCACTTC
AGACACGGCGGTTTTCAGGGCGATACCTTTGTTGAAGGCGGTCTCGCAGGAGATACCTCTCGTCAGCGACTTCGCGATGTGCCCTACCGAGTGATGAGGG
GCGTCGTTGAGCGTGAGTTGCTCCCCTCTTACAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTACGAAAATGATAT
CATAAAATTCTTATTTACCTTTAATAGAACTTGGATCGAAGGAAAGTATTATACACGTGATAGTTCAAGGATAGATAATATACTGCAAGGATAAACTTAA
GTGAAGATATTATATCTGTAATATCGTACGAATGTGTTACTTTGATGCTTACTGTGACTTGACGAAAATTGGTATTCCATAGCAACAATTCGCACGATCG
TACGACTTTACTTCCCAGTAATACAACTCGTTCTTGTGCGCTATTATTGATACTAACGCAATGTAAATGAAAGAAGTATATACAACAAATTTATTATCAT
TTGCTGCTTAGACCATTTCATCAAAATAAAGTGAAAAAAATATTTTTAATTACTCAAAAATGAAGAAAATAAAGCTGTATGGCTAGCCGGATGGCTACAT
CCGAATGGGAACTCTACACGTAGGGCAGTTAGCTACATTTTCGGCCTGAATGCTTCTCGCCACGTACATTGACATGCACTCGGCACACATGGCATGTCAG
CATGAGCGCGGGGTGACCGGCGCCACTGGCGCGTACTAGCAAATGGCGCAAGTTGATAGGTCCTCGTCTTGGTCCTCCTCCCCCGTAATGTCGATCACCG
TTGGGGGAGCTGGTGCCGAGAAAACACGTCGTCGTCGAGCAGAGCGGGGAGGTGAGCTCTGAGCTGTTGTTGAACCCCCTAACTCAATGTCCCCAGGCAC
AGACAGGACGAGCGACTCAACAACAGTCGTGGTCACGTCACCTGCGGCCGTAGTGATGATACGCAGGTCAAGCTCGTTAAGCGCGTCACGGCGAGCGCGG
TGGTACAGCTTATCGTACTCGCGCTTGTAGGCTCGGGCCTTTTCCAGTCGCTGAGCCTTTAGGATCGGGTACCGCTTTTCCAGGCACGCACGCTTGCCAA
CGAGCTGCCGCAGACTTGAGACAACCCAGTTGGTGTTGCACAGGGGGCAGTTGGCACCATGATGTTTTCAATAATGAGGCACCTACTTATTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTTGTATACCAGTGGCTACATTG
CATATTGTCTGTCAAGACATAAGACAGTTTGTCGGACACTAGTTTGCGCCATACAATTGGCCAAAAATGTTCAGGTCTGCTCGCCACGACAGCGGCAACG
TTGAGCGCCGAAACGATGCAGTTGCATGATGCGGTAGGGTAAGTAGCCTCCTGTTCACACACGAAGCGATGTGCCTGTAGTTGGCCGCTGGCAGCAAGCT
TAAATATCGGCATAATGACTGCACGAACGCGTGCATGCAGTCCGTGGAGCTGTTCCACTCAGAGGTGCAGCCGTTGAAGGGCACGGAGTTACGATGAAGT
TTGTAGACGTAGACTAAGAGGGACAAATAGCTCGTAACGGTACTACATGTACATTTTAATGTAGTAATTTTTATGCTTGAGCGTACATCATAGTAGTTGT
GAAGGCGAGGCAGCCAGGGAACGGTGTTGCCAGTGGGCTTCCCGAGATCCTCCGACCCCCTCTTACCTAATCATTACAGTCCAGCAACAAAATGCAACCA
CGTACTCTGCAACGGCGATAACACCTAGATATTGTACCTACGACGCTGAGGTGCGGAGGAGCTCCACACTGCTGCGCGGGCGCTCGGCGCGCGCCATATC
GCTGCTGGGCTCGACCTTCGGCATCGGCGAGTTACTCGGTATCTCCTGCAACTTAGCCACTGCCTGCAGCCATGCTTTTTGCGGATGCTACAGCGTAGAC
TGGTTTGCGTGTGCGCCCTCTATCCGAATCTCCATCTTCTATGTAGTGTTAGTAATTTACTGTAGAAAGGAGAGTTGGCGTGGTGGGGTGAACGACTGTT
GTCGTTCACCCCAGTAAAGCGAAGAAACATTGCTCCACTACGGGAACAAACGGTCGCATGATAACTGTGCTATGATGTCCTTACATTCCATTCCTGGCAA
GTATATTTAAATCTTCTAGCAGGAGGTTAGTGCATGGCGTCAGGATCAAAAGCCCGGACATTTTTCAAGTGCGCTGCCTCTAGTAAAGGGGGCAAAATGC
GCACACAGATGAATCAGTCCAATTTACGAGCCGAGATGCAGCAACACTCAAAACTACATAATACAATATTAACCAATGAAATTGCTACATTTGATTTGTC
GTCAAACTGTCTTACGAATGCTCGACACAAGTGATTGACCATCCACGACTTACAGCAATTCGTACTCGAGTACGATTTATAGTCGTGCTCGATAAGTCGT
ACGAGTTATTGTGCTTTGCAGTTATTTTGCCGACCATTTTAGACGCTAAATATGGCAAAGCCTGCTCCTAAATATATGTGAAAGAAGATACACGGCCTGC
TAAAATTATGCATAAATCCACCTCCTCATATATATATCGACTCGGGAGGGCCTGTCAGCAGCCATGCATTGGCCCAGTACACCACCGTCCATGATCCCCA
GCACATCCACCCTCTTATGCATAATTGCCGTGTGTGTAGGTGCTTGTGGATAAAAACCGACAGAATTGCAGCTGCACAGCCACAATTGCACTTTTGAAAG
TGCAATTGTGGCGCTTTTAGCGTAATTCTAGGCCTCCACCCATTTATGCACCTCGATTTATCGTAAATCTAGCAGGTGGTCGTAATAATACAGCAAATCT
CGCCTCATATTGCCAAAATCATTGCAAAGCACAAATACAGTCTGAAGTGCCAAAAAGTACAATATGTGTTATTATAATAAACCTGGCGAGATGTGCGCCA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGT
TTTTCACACTATTAGAACGCCTAGGCGTTGTATTCGGATAGACCGCCTAGTAGGCGTTCTACTTTATTTCAATGCCTGGGCGTCTGGTACGGGGTAAGAC
GGTAGCAGGCATGCCCCCATTCTCGCCACCGCCGCCATGATACTACTGCCACTTTGCTGACTGTGTACTGCTGTGCTGCTTTGCAGGTGGACATATCCAG
CGAGTTGGACTCCGACACTTTGGCTGCGTTCGTCGACGAGAGCGTATTCACTCAGTTGAGCGAGGAGCTTCGGAAGACGAAGAATGGCGACGATCAGCGA
GAAATCTTCCTATGATGAATTATCTGAAACAATTTGTCGACCCCAGCAACCTCCGGGGCTCCCAAAAAAACGATAGATAGCTTAACCCTATGGTTACCAG
AATGATACATCAAGTATCTTTTTACTGGTGATGTAGTAGCAAGATAACTGAAACAGCAATTTTCTGAGCCACGGCAGTTTCCTCGCCGTTTA