Description :
Non Conding Region
Location :
scaffold_1:1- 1338
Sequence
1337 bases(100 bases per row)
CCAACACTGTTATTTTGGCGTTGTGGTAGCATCAAAGACACTCGTGCCGGTAGAAGCGTTATTAGGAGGCTCGCCTAATGTATCTGGTGAGCAGAGACAC
TGCTTCGGCGTGGCGAGCAAGCTCGGCTTCGTACCGATGGCCCTAGCCTATTGCTACCAGTCCATGTGATACTATCATGTCCTGTACAGCGCACTTTCAC
TTTCGGCGTGCACTCATCGATGTGGACAGTCGCGCTTTCAACGCCACGACTCGAAATTTGTTGTCCGTCACGATCGGCAGAGACTGAACATTCCGCTCGG
CTCAGCGATGAGGGTGGACCATGTTCATTGCACCGATTAACATTGCATGGTCGCCGATGATGGCGAAAACGGACTGTTGGTTATGTAGCGGAGCGCATGA
AACCCCCTGCAACACTCAGACGACTGCCTACGACTGCTTGGTTGTGCTGCATATTGATGAAGTTCGCCATGTTCTATCTTGTCAACCATGTACATCGTAC
CCAGCGCGTGTGCACGCAAGGCAGGCACTATTCCCTATGCTGCAACGTCGTGGGACCTGCTTTCGTGCGTGAGTGAGGCCCTGGCTCCACGGATCTTCCG
ATCTCAAAGCTCAGTGGCGAGTGTACAACTTTGACACTGGTAGTACGTAGTAGACTGCTAGCTGTCGTTGCAAGTTGTCAACACATCCTGTTCCTTCCTC
TGAATCGGACGCAAAGTAGCTTGTGTGCTTCGTATGAATATTTGGAGCGCTGGTTTCCAGAAATTCTGACAGCGTTGGAGTGCAGTGTGCGGATTTTTCT
TGCTAGCAGGTTCCGCAGTTTCAGTCGCTAACGAATAGCGTGCGTCCTGCGTTGCGACGCCGTTCGCCTGTCTGAGCTAAGGGCTGAACTAACGCATGTG
TGCCCTGCAACTGCGGCCACTTGTGTCAATGCCATTAGTGAGCCCAAGCCCCGGCACTTGAAACCACATACACACCAGGTGGTTGCAGCCTTGACGGCCT
TGAACGCTGTCGTCAAGACGTAAACGGGTCACGGCGAGGATATCGCAAGGCGGTCGCATATCGAGTGGCCCATCCAGTCAGAGTGCGGCGCCACACTATC
CAGTGTCCGCACGTGCCGACACAGTCGGTATTTGCAACCAACCACCCCACGTCACTCTCCGGAGGCGACGTACACGCCTTGTAGTCCTCGATAGCTGCTC
TGCACGTTGTATCACACCTGTGCGACGCCTGTCCAAAACGAGGAGGAAGCGAGCGAGGCGACAATCGAATCGAACGAAGTATCAGTTAACGTAGCACAGG
AATCCAGACGTCAACGACACAGGCCAAAGAGGTACCA