Description :
Non Conding Region
Location :
scaffold_1:1- 12394
Sequence
12393 bases(100 bases per row)
GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
GGGGGGGGGGGGGGGGGGGGTGGGGGTTGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGTTTG
CAAGAGGTTGCTACGCGCGCTGGGAATTTTGAAATGCTGACATGGTTGAGCGATAACGGAGTGAACGGGTCAGGCAGGCAGTTGGTAGCCAACGCGGCTC
GGCGAGCGGATCCACGGATGTTAGCGTGGGTGATTGCTCGTATGGGTGCACCGTCAACCGATGCAGCGCTGGTTCAGGCATGTGCAGCCGGCCAGATCCA
AAATATGGAGATGTTAGTTCCTCGTTTGGGGCGTATACTGCCCGATGGTGCAACTCGGGCGTCCGCAGCTGGGCATCTACATGTCGTACAATGGCTTCAT
GCGCATCAGTGTGCGTTTACCACACACGCAATGGACACAGCAGCTGAGAACGGGCATCTTAACATCGTGATATGGTTGCACAACAACCGAACTGAAGGGT
GCACATCAAGAGCTATTGACGACGCTATTTTACAAGGTCACGAAACCGTTATCCATTGGCTATTCCAAAATCGGAGGGAAGGATGAACGAATTGGGCTAT
GTATTGCGCTGTGACCGGAAATAATTTGAGGATTGCAAAATGGCTGCACCAAAACGTGGACAAACCCTGGCAAGGCTTACTGATGGACCAGTGCGCATTG
TCCGGATCATTGGAAATGCTTACATGGCTTTATGGTGCATACCCAGCATCATGTACTCGCGATGCGATGGACAACGCAGCAAGAACAGGGAGGCACCACA
TGCTGCAGTGGTTGCATAGAAACAGATCCGAGGGTTGCAGTAGCGCCGCGGTAAACCATGCGGCCAAACGCGGTGATCTTGAGATGGTGCAATGGCTTCA
CTTCCACCGCGACGAAGACTGTACATCACAGGCAATGGATAGCGCTGCAGCTCACGGATACACTGAAGTCGTCCGTTGGCTTCACGAAAACAGCAGTGAG
GGATGTACAGAAGCCGCCATGGATAGAGCGGCAGCAAACGGTTATCTCGAAACTCTTCAATACCTCCATTACACTGTCAATGCACCGTGTACTAGTCTAG
CTATGGATATCGCTGCAGAGAAAGGGCATTTAGACGTTGTTCGTTGGTTACACGAAGAGCGATACGAAGGATGTACGGAGCGCGCTATGGATGATGCTGC
AGAGAATGGGCATTTTGAAGTGATACGTTTTCTTCATTATAACCGGACTGAAGGGTGTTCCGAGTTAGCTGCAGCATTGGCGGCTACACGGGGGGGGGGG
GGGAATTGGAAATTGTTCAGTGGATCCAGGAGTTTCATCCTCACAACATTGACTTTGCTCAAATTCGACAGCAAGCGGAAAGGCATGCATGGCCAGAAGG
AGTGGTGAGAGGTTTGAGACTGGTGTAGTAAGGGAGACTATGTATCGTTGACACGTACCGAAGTCGCGTAATTCCTACTTTTCCCCCAACGTTGGTTTGT
TTTTATTTTTGTTCACAAACAAATGTACTAAGTCACTTTCGCGATTCATCAAAGATGTTGGTTGAAAACGCAAGTTCCAGTAAGTCTGCTATCCACCTGG
GACGTCACGGGTACGTTTCGTGTCCTGATCTAAGTCGACGAGCAAGTTGTTGGAACGATGGCCCGGGTTCCACCGCCCACTTTCGTCCAAGTCCATGAGC
CACTTTACTGTGTATACACTTGGGCGTAGCTTGGAAAAGCGAGTCGGGTCAACTGACAAAGTGGTGTGTAAGCACCGGAAATGATTCGAAGATCGAACTC
GCGATATTGCCACATATACATGCTCGAATTGCCAACCAGGCGCGTTATTATACCCGTCCAACAATGCTATGACAGGATCAAAAGTGCTACCTTGGGCTTT
CCACACTGTCAACGCCAATGCCAGGTCCACAGCATGTTGTTCATAGCGGAGAGGTTTCAAATCCTTACCAGAGTCGTCGATAATAACTGCGTAGTTTTCT
CCATTTGATCGAACCACTCTATTGGGATTACGACCGATGACTTGTGTAGAGGGCTTCCATTCAAACCACGTACCCAATCGGTCTCTAGGTTTAAATCGCT
GGGCCAGTGGCAGCCATGAAGTACCCCACCGTCTCGATCGGCAATACGCACATTAATAAACTGAGGAGGGAATGGGAGCTCGACTATATTGCTCCCGCTT
TGGATAGCGGCCTCTGTAATCTGTATCGTCTCGACAGCCAAAGCAGCGTTATCCCAACTCAGCGAATGATACCAACATTTAGTTCCGTTTGCGACCCCAA
GCGAAACATTCCCGTTCGCGTTGTCTAGAATTTGAGCAGGAGCATCGTAGTAAAAATACCCAAACAACTCTGGATGCTCTAACTCGTTGTAGAGTAAACC
TCGAACGGCGCTGTGAATATCACCGAGAATTGTCTTTTTCCAACGAAACAATAACTTACTGCTGCGACGCGTTAATTCCATAGCCATGCAAGTATTCAAC
ACTACCCGATCCGTGTTGCTGGTAACAAGTAGTACAGACCCGGTTACCCAGCGAGGGTCATCAACGGCACCTTTCTTCGTGAGCGGCCTCGTGAATGCTT
TCATAATACTGGCATCGATCGGACGATAGTTGTTGTTTCTCTTGCCCCATCGATTTTGGTCTGGATACATACTGGGCAATACACGAAATCGCTGTAGTAG
CGCCTGCTGTGTTGAGCATTCCTTCGCGCGATGTTGTCTCCGCAAACGAAAAACCGTAAAGAGCGAGATTTGCTGCCAGGCCTTAAGCAAATCCGGGTCA
TTTGTCTGCATATACATGCATTTACAAAGCGAAACCCCTTTGACGACTTGAAGCTGCCAAAAGTCACCAGTCTAGCAGCGCAAACGGTTGCAATTAGAGC
ATTCAAGTATATACGTCATGTAGCCACTTACCAAAAAGATTGCCTTCCCGCCGAAGGGCCGAGAGCTATCGTAAAATTCTCGTAATCGCTTGTCCAGCAA
AACCAAGTGCTTTGCCTTGAACATGGAGACTTCGTCAACGACAACGAGAACCACATTTGGGCCAAATATCTGGCGTAACACTGCTGCTGATTGCGCGGAA
AGGCTAGAACCGGTTTTCCCACATTTGAGGGCCGAATGGAAAGTCCTTCCTTGGTGCAACTGACACGCTCCAGTCCCTGTCGGACACGTTGAAACTACCT
CAAAGCACCGTTGGTTGATATTCTGACAAATTTCGCGAACCACGAACGATTTGCCAGTTCCTCCGCCTCCGTGGAGAAGCGTCAGGCTTTGCGTACCCCC
GTCCAAACCATCAAGAACACGCTTGACAACAGCAAACTGCTCAATTGATAATTCACATGGAGCAATCAACGACCCTTTATCGGAACCGTAAAAACCACCA
CAAATTCCAAAATGTCGGGAGACGGAATCTTATTGCTATTCGGTTCATCGCCAGGCACGACAAAAGCTTGAAGCGAGGCAGCAATAGCAGACAATTTCTC
GCTGCGAAGTCCCAGCACACCAGACGCTGATAAAATGTTTTTTTTGCCAATGCACTCGCGGCAACATTCAACCGTTCTTGGTCATCAGTAAATACAGAGT
GAAACATCGATTTACAGACTCTATGCCTGCGCGCCTGCTAGCAGAACCAACCGCGGCGCGCATGAACAACTCGTGCAAGTCGGCTTCGCCAGATGTTACT
CCACAGAACTCAGAATTTCCAATGGTTTCTTCACCACCACGCACCGACTTTCGAATATCAGGGGTAGATGCCTAGTAATCTGCGCCACGATTTCGCCAAT
CCGTAGCAACTTGTTCATTGAAGCTGCTTTGGTGACCCTTTCTCATCAGATTCTGAACATAACGACAACGTTCCCTGTATACCAGCGAAGCTGAAGCGCG
GTCCCACGTATCGCACATACGTAATAACCCCGTTGAATCTAGCGCCCATTTTGGGCCAGCTGGCCCCCACTCCGTGAATGTACACAAGAAATACTGCGCG
CAGGAATCTCGTTTCTTTGCGTCTTGCTCACTCCAGGTCGGAGGAGGCGAACCCCCAAGCATAGCTGTTAGCATCTTAGCTCGTATAACGCCCTGGTGGG
AAGCAAATAGTGGATGCGTTGAAAAAACGGAAACCTTTTTCTTTCTGGCCTACCGCGGCGCGTCTCACTCGTAGAGGGAGCGTCCTTTTTTGGGACGATA
TCGACGATACACTCAAACTCCAGCGGCGAAAAATCAAGAAAGTGTTCACCCCGATTATAATAAGAATCCGCTTGAGTAAAAAAAACTATTTCCCCGTCAA
CCTTGAATGTACGCACACCACTCGATTTATTCACACGAGGAGGACCTGCCTGTGAATCGTCTTCATCATTTACTCGATTGACAAGCTCAGCTAGTTCATC
TTCAACTGATCTCTGCGGTTCGGCGGATAAGTCATCTTTTTTGCCGTGCGTATCGGAATCATCTCCACCATGCAGCTGTTTAACAAAAGCGACGAGCGCA
CGCGGGAAAACATACCAAAACGAATCACTTGAAATAAACGATCGATGGCCAGTTAAGGCATGAACCATCAATTTGTGCGACCTTTTGTGCGCGCCAGCGA
TATAGCTCACCGTTCTCGCCGCCAGATATTTTCCAATACGAAGGCTTGAATGAGCGTCCTCCGCTCGACTGGGATACTGTTCGTTGTGAATTGCGGCACT
TAACAACGCCGAAGCAGCTCCCTTCATAGGAGCATCCTCTTTTGTCATATAAGCTTGTTGATATTCTTCGATCATATCTCCTGCATCCTCACCGTTGATG
ATCGACGCATTCGTATGTGAACACGTCAGCGCCGCAAGTATAACATTTGTCTCGACCACTTCAGCATCCTGTGATGGTCTCGAAATCTCCCACATTAATG
ACCCTTCGCAATGCTGCCGAAATATTTGCCCAGTCGAGTAACTGGACCCCGCATCAAACACACGATGAACATGAGATGGTAATGAATGACCAACAACAAT
AGGCTGGTCGCCAGTACGCGGATTTCCTTTCCGTTCACGCACAACCATCAATGGGCATGTTTCATCTTCGTGAACACCAGCAGGGCGAGCTAAGCAGCAC
ATGTACTTCCCCGTTTCCCTTTGAAGCAGGTCGATGAATGAGAGTGGAAATTTGTGGTGGCAACGCGCATCTGCGCAGCACTGATGAATCCAGCGAAGTT
GCGGGCAGCGTCAGGGAGACCAATCTGAAACGCTTTCGGCAGCCCACCTTCGTTAAGACAATCCTTTCGCCAAGCATGTACGAAGTCATCCAGTTTCGTA
CAACACACAGACTCTAACCAAGTCGAGGCACGTTTACGCAGCGGCGGCGAGCACATAATACGCGATAAAACGGTAGGGTTAAAGTTGGAGCCATAGAGCG
ACATGTGAATATGAAGTCGACCATCAGCTTGCGGTTCCACAACTGCTGCATGCGCCGCTAACACCCCAAAAGCCCCGGAATCGCGGGCAGCATAATCGCG
AGAGATTCTTGTGTCGCGAGCTCGTTTACAAAGTAGTATGTAGTTGTATATCTGCTTCACACATCTTTCAAACACGCGAGCCGATAGCGCTGGATACATG
TTTGAAACAGCTAGTCTGCCTCGAGCATTCGTACGAATGTCTGCCGGTAAGTCCTCCTGAGAGCAGTGCCTTTGCTGAAAAATAACATCTGTACGATTCC
ACGCGTTGAGATCACGTAGAACAGCTATACGTTGTAATTCAAGCGAATAGTGTTCGGGAGGCGCGACCGTGACCCAGTGTAGAGGTATCCCGTAACGTGC
TCTCAGGGTGTCCGCAGCGGTACTGCTATCGCTATGCTATTTTTAGTGACCAAACCACGTGGTTATTTTGGTTTTAGCATTGACACGCACAATTTATCTA
GCAGTGCTGTCATTCGTGCTTGAGAAGTAATGGAAGTAATGGATACTAGTGCAGGAGCAAAGTGGGTGGAAGATTTCTTGCAAGAGGCTGACGAAGAAGA
GGCTGTCTTCTTGAGTGCGGTTGAAGCCAAGCCTTGTGGCGTCGAACTGCTACCTAAGCCAGGAGGCTCGAGACCAGGACGCGCACCTAATAAAAAGAGG
GATGCCAGTGGAAGACATCTGAGGCTTTTGGAACAGTACTTTGGTCCCGATCCAGTTTACAATGCTCACGACTTCAGGACCCGCTTCAGGATGACACAGC
CACTGTTTCTTCGCATTGTACAAGGTGTTGTGGAGACTGACTCGTACTTCGTCCAACGACGGGATGCTACCGGGAAGTTAGGCATTTCAAGCCTTCTGAA
AATCACGGCTGCGCTTCGACAACTAGCTTACTCGGCTGCGGCAGATTCAATTGACGAGAACCTTGAAGTCGCAGAACCCACTGCATTAGAATGTTTAAAG
AGATTTTGTTACGCAGTGATCAATTGCTTCGGGAGGGAATACCTTCGACCTCCAAATCAATTGGAAATGGGAAAGATTCTGCAGCAAAATGCGCTTCGTG
GTTTCGTTGGAATGATTGGCTCTGTGGATTGCATGCACTGGCAATGGCGGAACTGCCCATCAGCACTTGCTGGCCACCACAAAGGAAAAGAGAAAAAAAC
CAACGAAGGTTCTTGAAGCTGTAGCCGACTACAACCTGAGAATTTGGCACTGCAATTTTGGCTCTCCAGGATCTCTGAACGACATAAACATACTAGACCA
ACGAACATATTTGATGATTTTCTACAAGGCAAAGCTTCACGTGTCGAGTATACTGTCAACGGTAAATGCTTTTGCTTTTGGATATACTTTCTGAGATTAA
CATGTTACATATCAATAGCCTGTAGGCAACAAATACTACACGCCATACCTGTTGGCGAATGGGATATATCTGAGTGGGCTGTTTTCGCCAAGTCAATCGA
GCGGCCCCGTGGAAAAAAGCATAAGTACTACGCGTGTCGACAGGAGGCATGTCGTAAGGATGTTGAACGTTGTTTCGGCGTCTTGCAAGCACGCTGGCGT
ATCTTAGATACGCCCTGCAGATTGTGGCGCGTGGATGCGATGGGTACAGTGATGCACGTATGCATCATTCTACATAACATGATTGTGGTAGACGAGCTCG
ACGATCCAAGCTTAACAAACGACTACCTATTCCAACCTGGTGCTCAACCAGGAGGACTACCCTGTATACAAGTAGTTCGACCGTCCAATGTACCGCGCGT
AGTTACAGTGGCTGATCTCATCGCACACTCGCACGTACTACATAGTAAGCGACAGCACTATCGATTGAAAGATGATCTGATCGAGCATTTGTGGGCTCTG
TGTGGTGAGAACGATTAAGATTGCTATTAGTCTTTAAAGCCTTTTGTATTCAATCTGAGTTAGATTGTTTTTCGTGTCCAATGTGGTATAGCATTTCAAA
TTGTTGCCTAGAAATTCAGTAAAATGTCGGCATCACGGGGTAGAGAACCAACCGCAGCACCGGGCTCTCTTTCGGATACACCTCCAACATCGCCTCGATC
TTGAGTATCTGTGCCGTTCACAACGTCACGTTGGGCACGTCCCGCGTCGTTAGACGTCGTAGATTCCCGCGAGCCAGCGTTGTCTAGCGCAGCAGCCTCT
TTGCGTAGTCGCGCGAGTACGATTCTGCGCTTCAATCGTACCTATTCTTTTGTGTCTTCGTCATCTTCGTTTGGCTGTATGCTAAAAAGATTATGTTCGA
CTTGTTCTTGAGCAACGCGGCTTCTAAGCTCTGCATTTTGGGCCATGCGCTCCGTAGCTTGTACTTGGCGGGCGTAAAGTGCGAGATTGGAGCGCTCTAG
CTTCGATTTCTGGTGGCCAGGAGGGCGTTCAGGACGCGCTGGGTTAGCGCTCGTTGCTCAGCGTCCTGGATGTCGCTTGACGATTTAACAGCATCGTCTG
CTCCATCGTCAGAGCTAGGCAAATGGGCACGCTTGCTCGGCGATGACTTAGCCTGAATGTCGGAGCGCCACGCACCCCATTTGTCCGAATCCCTCAAGAT
TCGCCAGCGGTGCATGAGCTTAAATCTCCCATTTCGAGGCTCCGACTCAAGACGTTCGACAGCTTCGTGCTCGATGTCGGTAACAGAACGCCCACTTAGC
TCCAACGCTGAAACCTTTGCATGACAAGCAACAAACTTCGAGACAGAAGCTGAAATAACTTGAAATCTTGTAGAGAGGGAAGTTGCTTTGCGTTCTGCTA
CAAACTGATTTTGCGCATGTAAAGGCTCGTCAAATACGTTCTTAATTCGCCTGTAGAACTCGTCACCACTCTGGTTAAGACCGGTCTCATCATCACCACT
GATTTCGAGCCATGCTTCACACAATATCTTGTCTTCTATAGATCGGTAGTTTGCCCCACGTGTGGTCATCTTTCTCAATGGACAAAAGTTACTCGCACCG
TCGGATGCTATTTTCGCTGCCATATTTGGTAGTGAGAATAGCATCCGAGACACGTTGCTATTTTTTAATGAGCAGTTGGCAGTGCCGCTGGCAGCATCTG
ATGCTATCCTGCTGCTAGATTTGGCCTTTAATGAGCGTTTACCACCACCGCTGCGGACACCCTCAAGGCACCAAGTTTAGGCCTTGTTGTCGCCCGTTCG
AACGCAGAAAAGGGAACACACCCTCCCACCAGCGCCAGTATTCGAAGAAGGTGCGCATTTATTCTTTTTTCTTGGGGAGTATCTGGATTTGCTTTTGCGT
CAACAAGAACAGCTCGAAAAGCCTCCGAATTTGCAAGTTGACTGAGGTGTAAAAGTACTGATGAACGGGATGAACCAATCTGTGCAACTTTCTGGATAGC
AGTGTGGCGTTGTAACTGATTAAACAACGTAGCAACAAGCGCGGTGCATTTCTCGAAGCGTCCGTCATAGTACCGCATCAAGTGCTTTACAAGCCGAGTA
GGCCATGTACCTTGCGGCAAGCATTTCCCCCCGGTCATAAACAAACACGGGAACGTAGCAGCAACCATGTCCCCATTTTCTGACCACTCAGTAACAGGAA
TTTCTCCTCGTCTGACAGTAACTACAGCGGGTTCAGCCCCGGGCGACGCTTCCGCCACGCGTACATTCTATCCACAGGAAGTAGAAATAGCTGGCGATAC
CCTTTTCCGTTTGTCTTCCACGCATCCTTTGGACCCACAAAAGTCACCCTCGGTATGCAATCGTCTGCAGTACACGGCAACACCGTCGAACATTCTGCCG
GACCAGTCGAAGGAAAGCAAATGGAATGTCCAATGCTTCTCGGATACAACAATCTCCGTTTTAAAGGCTCTCACCGGGGCAATACACTTACTTGCTACAT
CTCCCAATTCAGGTAAATTACCAGGCCTGCCGTAGTCGTGCCCTGACGCAATACTAAATTCTGATTTGCGCGGATTCGTAGCACCGGGATCACACAGCGG
GAAAAATTGAAATCAGGCACCAATTCAGGGTTCAAATGGTAATAAACCCCATCTTTCTGGTAAACTTGAAGATGATTCTCCACAATCCAGACTGGGTACT
CATTAACCAGCTCGATCTCTGTTGCTGAATATTGAAAGCCAGAATGCAACTCATTTAAAGCAAAGTGCCGTACGCTAGCATCCACAGAATTTAGTATTTC
ACAACAGGAAGCACACGCCCAAAGATCCCCAGAGCTCCCAGAACTTTTTAAAACACGTAGCTGGCACAATTCTGCGGTTTTTGAAGCGACAGGATCATCG
AGATTCTGGAGTAACCGATCCACAGTGTTCTCGCTACTCACGCTACATAAACTCTCGTCGTTAAAAACACACGCCTCTGGATTGGTCCCGCAGCAATAAA
AATATAGTAGGGCGAGCCGAGGGTGCTTGGTAAAGTTTTCACGAAGTAGATCCAGTTCAGCAGTAGATAATTTTGTTTTGGTCATAGCCTCTCTAACCAG
CACATCCAATTCGCGAGAAAAATCATTTTTACCTGACCGTTCCCAGTGTTCCCCTTGTTTTACCCTTTTGGAATGTAGTTGAGTTTCCGATTTACGTTTC
CCAGGCATGGGGCGGCACAAGCGTTCGCTATTCCGGCGAGACAAGTTACCATCATCTTCACTTTTCCCGCCGAAAAAGTATTTGTTACCGTCATTGATGA
CGGCTTCAAACCGACACTTTTCATCATCATTCCCAAAGCATACAGCAACATAATGATTCCGTTCCGAGAGAGACACGACTTCATTGACACGCCCCGCTGC
GCAATGGTAGATAGCAATAGGCTCTTCATTTTCCACCTCGTTTTGTGTAACATTGAATATCCCGTCTGTAGATAACGTAACAATCCTGCGTTTCAACATA
TATGCCATAGCCGTAATAGGTATCACACCTGAATATTCCACCCTCTGATTTGGTCGCGCCACCAATAATCCAACATGGAGTGGTTCGTGGCCAAACGCAC
TGTGCAATTTGCCTTCACGAAGTAGACGAACGACTTCTAACGCTACCTTGACCCGCAAATCAAATACATGGGCCGACGCCGGCAGATCAAAGGGGAGACG
GATGCCTGCCAATTCGGCAGCCGACACCACAGCGTGATAAAGACAATTCCCGCGCGCGGGAACATCAAAGCCGGAAATACCCACAGACACACCACTGCCT
GCTAGGACACCAAGAGTTGTCCTAGCCTTCCTTACCCCCACGTGGTCACCACGTTGATGGGCAGCCCTTTGCTCTGCTCGAAAACACCATAAAGAACAAA
TCTCTTCTTTCATCCTCAGCGCTCCCAACGACAACTGGGATTTCAGTTTTTGTGATGCACGTTGTACTTGATTGATAGAGACGCATGCCCATTTCCAGGA
ACACTATCTTTGTCATATTCAACGAATACTACACCCGCATTTTCATTAACGTTGCTCTCTGTCAAAATCCATCCAAACGCCGTTTTTGTCTAATTGATTG
ATAGGGATGCGTACCCCTTTCCAGGACCCCTCACTAAGCCCTTTTCACAGAACTCTCTTGTTATTCTCTGTCAAAAGCCATCAAAATGCGGATTTCTCTT
GTCTTTGATCCAGAACGTGTTTTGCTTCGTGACCCGCGGAAGTCGCCCACCGTTCTCGGTCTTATACTTGGCTTTCGCGGCGTCACCAAGCATACGCTCT
CAACGCAACCACTGATCTGCCCTCCATCTGTGCTGAAGGAGCAGTTGGTAGGAGCGGAACTGGGATCGGTAGTGGTAGGATTGGTATGCAGATCTTCTAC
TTCAAGTAGGCCACGGAGCTGCCGCTCGTTACTAAAATGCATCAGTTTGGATTTTACTGCGTATCGAGCAGTCGCGGGGTTGAGGTCCCCGCGGATTCAG
AATAACCACATCTCAACGAATTTACCAATCAACGAACCAACTAAAAGCTAAACCCCACACTTACCACGCAATCCATCGCGGTGCAGATCGATCCGCAAAA
TAGCCGCCTATCGACCCATCGGCGCCGACTACATGTACAACGCTGTACAGAGAACTCACTGGTCGCAATGTCGTTATTATGGCTGTGCGTTAGGAGGAGA
GACGCACCGCCGTTCGGTAAGGAAACGCTGCACGAGCTGCTTCAACGGCGTATGATGTCAGTCTCGTTGACGCCGTCTGCACGATGGCCTGTAACACATC
GCGGACTTTTCACTCCAACCCGACTGCCATCCTTGTAGCTTCTGGTCACTGTTGTAGTGCTCTGCTTGGTGTCTGTCGTGACGACTCCGACCTCCTGCTG
CCCGACTGCCACTGATCCGGAGCCTGAATTGCATGCGTCTTCACTTCGCATCGTACCGTTAAAGCACTTGCACTGCCGCCAATACCGGCAGCGCTCGTCG
ACGCCATCGCACCGTACATGTATACATGTCATAGCGCCGAAAGCGCGCAGGACCTGCACGTTTCGAAACGTTCCTGCACGCTTTCAGTGCTGCATTCCTT
GTGTGCGCGTCCGAGTAAGTATGTAAGTATTCATATTAGTGCGCGTTTCCCAAAGCGAAGCCACAACGTTGTTGTTGATGCCCAGTTGTATTGTCCGATT
TTTGTCCATCGTCAAACTTGTTAGAACTTATACATTTCGGTGTAAAAACCTCTATACTTTGGAAAGTCGGAGAGTTTTGATTAGAAGAGAGAAATTTATA
AACAGCGATATTTTTAAGTTTGTATATCGGCCATTTGGCGTGTTTCACACCAAAAACGGCCTCCTTTGGGCTGTACGTACTACCTACGGTACCACTACCA
GTATGAATTCTCAAAAACGGTACTGTAGTGCCAGGTCAATTAAACCTTAGCCAATCAAAAGTGAGATTTAAAGAAATCACAAACTTGAACTGA