Description :
Non Conding Region
Location :
Scaffold_1:1- 122
Sequence
121 bases(100 bases per row)
TGGTATAACTACATGTTCTAATTCACACGGATAAAAATAATACTACCTGCCGGGTATGGCGGTTATCAGGATTTCGACAGTATTCGGCAAGATGACAACA
TAACGTGCAATGGTCGCCGTC