Description :
Non Conding Region
Location :
Scaffold_1:1- 11628
Sequence
11627 bases(100 bases per row)
TTCACACTAGCAAAATTCGCCCTGGATCACCCCTTTCATCGCTTCCTACAGCGACTTTAGCACTCTTCAATTACACCAGCAATCATCCCCATTCAACGCC
AATTATTGCGTTTTCACACTAGCAAAATTCGCCCTGGATCACCCCTTTCATCGCTTCCTACAGCGACTTTAGCACTCTTCAATTACACCAGCAATCATCC
CCATTCAACGCCAATTATTGCGTTTTCACACTAGCAAAATTCGCGCTCGCTTTGCTCGCGGATAGTGCCCCTTTCATGGGCACTATCGAGCGGCATATTT
TCTGCTCTTTATCGTGGATCAGCTGGGCTAGTTTAGTGTCTTCTTGGTCTTATCATTGAAAAGCGGCGTGGTTTGCCGCGTGACCGAGTCGGTCCATCGA
TGTCCTTGCGCAAACGGAGCATATCGCACCGGTGGTTGTCATGTGTCACTCTACACGAGCTTGATCTACAGTACGCGTCCACATATATCTCAATAAGTTG
GACAAAAGCTGTGGATTTGGCAATAGTGACGACGAGCCACGCGGTGTATGCCACACGTAACTGAGAGGCGACATGAGAATCCAGGTAAATTATGGGTCAT
GCCAGCGCACTGCGTTGCTTTTTTAGATGCTCGCACCTCCTCGACGCGGACGTATTGTCGTCGCACCGGTCGTACGTGTCAGTGTCATTGCTGTTGAGCG
ACCGCATAGCCTCGGTGGAGTGGCCGGGGCCAGCGATCGTCTCTATTAGCTGTACCGCACATTTCAGATGTAGATGCGGTGTCAGTAGAGACAGTCTTGG
TATTGATCCAGGAGAAGACTGCATTGGTCGTGCTACCCGTCGTCGGGAACGCTACCAGCGTGAGAGCTGGGCGAGAAGGTTGCCGTGTGTCGGAGGTTAG
ACACAAAAATGCATGATTTGCGATGTAAATCGCCGAGATCAACAAAGAGGCGTGAACGCGAGGGCGCTGGGATTCGCTTTTACATTCCAGTCATAGTCTA
CGACTACAAGTGTATAAGCGTACTTATATGTGGTTCAATACGCGGCGCAAGCCCGACAAGGTTGCTATGGACCATGCTCGCGTTTCATTGTAGTATGGCT
AAAATGTCAGAAATATTGGAAAATGCTGGGATCATTTCCAACGGCCCACTACAAGTCGCTAGTGATGAACAGAGGTTCACCGTGCTGATTTGCGGCATCC
CTGGGCACTGGGTGATTTCGCAATGAATTGATTGGAATAAGACTGCATTTTCGATACCGCGCTCTATGCACGGAGCCACGACGCTGTGATCATTTCAGTG
GCCAAGGACAAGTCTGTCTAGCATTATGAAGGCTCAAAGCGCCATGTATTGGCTCGCGTTGTGCGCGTCCAACCTTAATTTTCGTATTACCATAAATACC
AGGCGAGTTTCAAAACAAATACTTGCATGCCTTTGGTAGCCACGTGCGTCGACATACAGCCTCTCTAGAGCTAGAGAAAGCGCCCTTGAAAATATCTCAG
CTATTTTAGAAGGTTGCAAAAGTTTCGGATCGACGAGCATCACGCCTGCCGTAGCGGTCGGTGCATGGCCAAAATGTAAGATATATTGGAAAATGCTGGG
ATCCTTTCCAACGGCCCACTAGAAGTCACTAGTGATGGGCTTGAAGAGAAATAATTTACGGGGGCGTTGAGGCACGGCGTTCCGTGGCAGGAAGAACAGT
CCTGTTGTACGAGTACGTTGCAGATCGTGCAGCGCAGCACGCCAAATTGGATCCTACAGTCTACAATTAACCACCCAATGGTCAAGATTTGAGGCAGCGT
CGCCGATCGAGGCCACAGCGTCTCCGACCTTAATTTTGGTGATGCCATAAATACCAAATGTAGCCACATTCGAACGCCGAAGGCTCGGTGAAGCGAGAGT
AAGAGCACACCTCATGATTGAAAACGAAAGCACTCATACTTGGCATGATGATAGAATGCGCTTTGGAAAGTACGAAATGCTATATGTCGTCACCTTTCGA
GCTCTACAGCGAGGGTTCTTGACAATATATTGTGCATACTATTTGAAGCCAATATTTCCTGGTATAGTGTATGCCTTCAAATAGTATATTAAAATGCAAG
CGGCGCCGTAGCGGGCTCTAGAACCACCATCGTCAATGTAATATGCTCTTCGATACCATAAAAGAGAGATAGCCCTCTCAGATTTTGCTAAAAGTGCGCA
TTTTTACTCGAATTTCTATGTACAAGTCGGCGAAAAACGACGCTCGGCAGTACGAGTTTGCTGTGATAGCCCAAGCGCCTACCACGTCCCAAACGCAAGT
CACTGGGCCAGACCATATACATAGCCAGCTGTGGCTGCCCGCGTCGGAATCGGTCGAGATTTCAAACTGCGCGAAAACACGTTGTGCATTTGGGTGTTTA
TTTGGTCACCTCAAAACATCAACTTTGGAATTCGCATGCATGCGCTACGTTCGGCGTCCAAACCTGCATCTCCATGATACCGAGATGCTATAGAACGACA
GGAACCGGTGCGGCCTTGCGTTAACGCGACTATGCGGCGTCGATCGTGGTAGAAGTTGTGGTGCCCATACTATTTAATATATATCAGCCTGATATAGTGT
TCGGTATTTATATCACTGATATGCCTGTGAATATCGAGCTTTTAATTCAGGCCTTAACGTCGCCAATAGCAAATTCGTTCTCGAAAACGAGTTTGAACAA
TTACCTATCCATTGGATCCAAGTTCTATGCCCAAAAAGCTGAGTAGCAGATGAATAGCGGGAGACTCTAAGCCTCGTTCTTGGCGTTCGGGTCGGCGGCC
CGCTTCCCCGCGAGCTCCTCGCGAACTTGCGCCTCTTAGGGGCCTTCATCTTGATCTTGGTGTACATCGTGTCGTCCGGCGTGCAATAAATGCCGACAGC
GTCGCACGCGACGTTGGTAATTTCCAGCGCCTCGAGCGTCGTGACCACGCGCGACTGGATGACGTTGCCCAAGACGAGCGCTTCGTGTTGATACCGCTGG
CGGCAAACTCGAGGCGCGACGCAGCGTAGACCTTGGTCTCGAGTAACGCGTTCGTGAGACCCGGCATCGCGCCAAAATGCGTCGACGTGTCGCGCGCCAT
CTCATGATTCTCGTCGTCATCGTGGTCTTCGTCGTCGTTTTCGGCCGGCGGTGCGAGGTCGTCTCTCGAAGCGAACCGGACTTGGAGTCGCAGTGGCGCG
CCGTGTGCGACAAGCAGGTGGTGCGAGAGCACGAGAAGGCGCGGGACGAGCGCGAGATTCTCAGTCTCGTGCGTCTCGGGCCAACGCGCGCAGGTTGCGG
CGGAGGATCCCGATTTATGAAACTAGTCAATCTGTGAGACGCAAGTGTCGTAAAAGATGTGTGGTACCTAGTTCCAAACGCGAACAAGCGTCGGGCCAAC
GCATTGGAGAACGAGTCTGGCCAAGAATACCGTGGACAATGGGGCGCGCGACCACTGTAGGTGACTGCCAAGGGCTGGAAGCTCCGGTCGCCGGAAGCTG
GCGACTACCCCTTAAATGGTGGGACTATAACACACGTGTGCCTGTTAAATCGAAGAAAGAGAAGAGAAGAAGGAGAAAGTTCGATATGACGTGGCGATCT
TGTGCAAGCGGTACTATGCAAGCGGGTCTGTGTGCGCGGCAATTGTGCAACATGGCATTTAGCTCATGTTTTCATGCTGGTTTTTGTATACCTCTGTGGT
ACCTTATAAACGTGCCTATAAGCTCGAATTTCTACCAATGAACGGGCGCAAAACCCTTGTAGCCAATGCGGGTGTTGCACTGCANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGAATCGTTGGCGC
CGAGTCCAGAGAGCTCGGCATTGAACTCGAGCGTACTCGCGGAGAACATCAACCCAGCAATATGTGCTTGCGCAATGATGCTGCTAACCTTTTCTCAACA
GTAATGCCTTATGTACGACCCGATATGGCGGCTCGTAGAGTCTCTATATACCACAGCCCCACTGTAGCTTATAGATCGTGACGACTTTCTCGAGCATCAT
GTACTGCTTCTTGTGCGTATTTATCACGAGGGTCGCGAGACCGTAGCTCGGGTTGAAGCGTGTGGCAAGGCTGGCATCAACCCGTGGAATCGATCTAGGC
ACCGACCACTGAAGAACGACAATATAATGTCCTTCATACCCTGATGGGTCGCGGCTTCCTCTGAGCGGCAATAAAGCAAGCTCCCTCGCGCTCCATGTCG
CCAAGCGCCAGTGTGCTGAAGCGCCAAAACGCTTGCGCGAAGATCGCGATCTGACAGCTTCGAACTTCGTGTTACTGAATTATTTCTTTTAGACCAATGC
GGGTGTTGCATTTGACCAAAAATCAGCCAATGCGGTTGCCCAAAGGCAGTGTTAGAGCGATTTTAGATCAATGCGCGTGCGGTATTTCACCCACCACCTA
ATTGGTACTCCCCCGGAAGCTCGAGCAGAGAACGGATCTGATGCGACGTGGAGCGAGGCGTTTGCGGGCGGTATGTGTGTCGCTGGGCTGTCAGCAGTCT
CGGCGCCGACTGTCGTGCAAGCAGCAGGACGTAAAGACGTCCTGCTAGTTGAGCGATAATTTTCTTGTCGAAGGCACTAAAGGTGGCCATTTGCTCTTTA
ACGTTTTAAGAGCGCTTTGTATCTGTTGTCGAGGATTGCGCGCGCTGTACGACTGCAGCGGCAGCGTCGCGTGGCCTGCTCTACTCCCCAAAGTGTCTCC
TATCATTGTGCCAACTTTGGGCGATTCCATTTCAAACGCGATGTGGTCGACAAGTGGCGTCCGCATCGTGAAGTGGCGGCCTATAAGATGGCACTACGAG
CTTAGTTTGGTGCGCGTCGTGCCTCTCAGATGGCACTACGATCTTAGTTTGGCGTGCATCTTGGATCACGTCTCGCTGCCACTGTACGCCTCGCTCGTCG
ACGCGACCTCGCATTCTGTGGTCTCCAAAGCGCCCTCTACAAGTGTGCCGGATCTTGGCGAGTTCATTTTCAAACGCAATGTGGTCGATCTGGCGTTGGT
TTGGATGGAATCGCGCCACGAGAAAGACTGAAAAGTACGAAATTGTGCAGTGTACGACGCTTGGTGTTGAGCAAGACTTTCGATTCCGGCGACAACGACG
GCAGTCTCAAACAAATAGTACGCGATCTTCTATTAGGACGACATCAAGCCGACGCCGTCGACAACGCCGTCCAAGAGCAGCACAATGTAAATAGTGTTGC
GCAGCTGGGACTTGACGACGCGGTGCGCGTCCTAGTCGAGGCGCGTCGCTGCGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATACGGCGCAAGATGCGTGAATTGCGACGATGAAGTCGGACG
CCGCCGCGAGCACCGCCTGCCACTGAACGAGTGCGTTCTTGCTCGAGGATGTACACACCATGGAACGCACCCAGGGCGTCGTCGCCTGCAGCGCGACGGG
CGCTGCCGAAAGGTTGCCTAGATGGCATGCAATCGCATGCTGCTGCCGAGCTCGGCGCGGCTGTCGTCGACGCTGGCGAGCTCGGCGTGGTTGTCGTCGA
CGCTGGCGATGTTGCCAAGACTTAACGAATCCGACAGCGGCAATCGAGAGGCTCTTGCTGCCCTTGGCGATCTGCTGCAGCGTCTCGTCGAGCGATGCGA
CTGCTTTTGTGATGAAACCCCGCTTCAAGGCAGCGAAGGGTAAAAATGACCCGTGTCACCGAGCGGCTAAGGACCAAGTAAGCCAACCGACTGCAGACGT
CGACAGGTATCTCCATCGGCAAGAGCTACATGACAGTGTGTATACCAAATAGAGATCAATACAAAGCACTACGCACCGATGGCCACAGCAACGAGGGCAA
GTTCGGGTCGATAGGAGAAGGCACAAGCTGCTGCAGTGCAAGAGTGGGCGCCGGTGCCAGCGTCGTCGTCTCATCGAGGCGCAGCTATCGATTCAACGTC
GAGTGGTTTCACGTGCCACGGCGGCACCAGCGGCACGGTGGACGTGCCGATGCCATCGCGCGCGAATGGCGGTGAAGATGCAGCGTCGCCAGTGCATTGT
AGAGAACTATCTCGGTGTCCGCTGTCGCGTGCTTGATCGATCACGGCGTCAAGCGTGAGAGGCGTCTACTGCCTCGAAAAAGTCGTCCAGACCTGGTCGA
CACCGATCGCGCGCGTGCTACTTGGGTCGCGTACGTTCTCACAAGCAGCGACGGGGTTGGAACCTCGTTCGATTCAGACGCCTAGTCGCATTGTGAGACA
AACTTAACGCGCAAGCAGTGTAGTACCTTGTGCCAGACGCGAACAAGCGCCGCACCGACGCCGTCTAGAATGTGGCCCGTGCCAATCTCGCGTCTGCGCC
GTGGACCCCGGGCGCGCGCAGCCAAAGATGATGGCTGCCGAGGGCTAGAAGCTTTGCTTCTTGGCAGCGCGCGCACACGTCGGATTGCACGCGACGTCGG
GCGAGAGGTTCTCTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCATGCTTGGTGTGGCTCGGTG
TCGAGAAGCATTCGCACGCTGCATGAGAACGCAGTGGTCGCTGCAAGCGCTAGCCTGGTGATTCAATGCTCTGAATCGAAGGTATGTGCGACGAAAGAGA
GTCCTCGCCCACACGAGTTTCACCGTTCACAGTCGGCAGGAGCGACCGCCCTGCCGTATGACCGAGGCCGTCGATCGCAAATTGCAGAATGAACAGCGCT
CCAGGTTTTACCGATTCTCTTGTAAAAGCACTGCGTTTCGTCTTTGTCGTGCTCGTTTTTACACTTGTTTCTACACGACTGAACGTTTGCTTGGAAATGG
GGCCTTCTCCGAGTGCCACGTCATAGAATTCGAGTAAACTTGTGAATATCTCATCTCTGGTATACAAGGACGCATTATAGCCTGGCACGCGGTTTACACG
AGTGATATTATACGACAGTAAATCACCGCGAGAGAGTGCGGAAGTAAAGTCCATGCAATCCGAGCACTGTGAGCTCAAAGCCTCTCGTCCCAATCGCTCC
ACAGGATATGATGGCTCCATAGATGGCTCCTGGACGTAGTGTTTGCACGAAAGGTGCCGTGAGTCGCATTCTCGATCCAGTGGAAGGACGATCGATCGTC
GCTACAAGTGTAAAAGACGTACCGATGTGGCCATTTGCTCTTTAACGTTTTAAGAGCGCTTTGTATCTGTTGTCGAGGATTGCGCGCGCTGTACGACTGC
AGCGGCAGCGTCTCGTGGCCTGCTCTACTCCCCAAAGTGTCTTCTATCATTGTGCCAACTTTGAGCGATTCCATTTCAAACGCGATGTGGTCGACAAGTG
GCGTCCGCATCGTGGAGTGGTGCCTCGAAGATGGCTCTAGGATCTTAGTTAGATGCGCGTCGTACCTCTCAGATGGCACTATGCGATCTTAGTTTGGAGT
GCATATTGGATCGCGTCTCGGTACCGCGGTACGCCTCGCTCGTCGACGCAACCTTGCATTTCGAGCTCTCCGAAGCGCCCTCTACAAATGTGCCATATCT
TGGCGAGTTCATTTTCAAACGCAATGGTATCTAATGCGCGGCCTGGTGATGCTTAGAATGCTTCGAGATGGCGCGCCACTCACTATGGACAAGAGCTCGG
CGGCCGCAACATCGTGACCCAAACGAAATATCCGGGTATTGTGGCTAACAGCACGCAACTTGTCGAGGTTCCTGATTGCGAGGAGTTGGCCGTCTCCGAT
GGCCGAACTCGGTCAAAAATACAAAATGGCTCAAAGTTGGTACAGTTGTAAAGTACGCTTTTTGCAGCACGTAGCACCAAGTTGGACCATCGTGCGCGGT
CTACAGCGCGAGAAACTGGTGTCCAAAGTTATGCCGAATTGTACTATTTGCGGCATCATGAGGGACGTCTACATGGCACATGCCATTTGTAAGAAAAAGG
CGATGGAAGACACAATCGCAGTCTCCTTGAAGTAGCCGAACGACGCTCTCTTTTGCCAAATGCATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACGTTGCCGCCGATGATATTATGGTAAAG
TACCCAAAGAGCTGAAAGTAGAGCATGGGGTTGTTGATCTGGTTCGTGTATACGGGGAAGATCAACTTGGTAAAATGCTTTATGTTGGCGTGGCACTGCC
AGGAGTCTCGGCTCGGTGCAGTGTACAAGCAGGAGGACGTTAAGCGTAAGGTGCTTGAGCTCGAGCCTTCGGAATCAGCACCGAGAGATGGCGCACGCGC
TCCGAAGACGACGCGGCGCTGGCCGTTGTGCAAGAGAGGCCGTCGAGAAATTGCCCAGAGCTCCGCCCCAAGGGCTTACTCGGTGGCTAGTCACGCATGG
ATAGGCTGCGCCATAGCTACAGCGACGTCGCGTGAGCGCCTCGGCCTGAGGCCTGCGCACGGCTTGCCACGCACCACGTGGCTGGGCTGGCGGCGATGAT
CGGCTCGAGAACTGCGGCAAAAACACTGGTGATTGGCTCCAAGAAAAATGCTTGCCGCTCTGATTGGCCACAAATCGAAAGTCTTGTCGCTCTGATTGGC
CGAAACGCTTTGGCCTGGCATGGACGAAAATGAGGGAGACCGACGAGGAAAGCTGCATTGCGACCGAGCGATACCTCGTGATAGCGTGTGCATAGAGACT
GTTGATGGAGTCTCCTCGAGCACAATGCAGCAGCGTCAGTGTGGCCCGACGAGCCTCGGCGTCGTCTTTCTGGAGTCACCTGTCGTTGCTATTGGCGTTC
GCCATTTACAACCATAAACAACCATATTTTGGTTCACAGGCGGTTAGGAGGAGGCGGATCGACCAAAATGAAGTTTGAAAATAAAATCGCCCATACTTGC
CAGAGTGCTAGACCACACTTTGGGGAGTCCAAAATGCTATGTGACGTCGCTGCATGAGCTCTGTAGCTAGAGCAAATGACAGAGCAAACAATATTTTAAT
ATAGTGTGCTTTTTCGCTATACTGAAATACTGTACGGGATACAATGCCTCATCACGCAGCGGTACCGCGCGCACTTTGCCTCTCTCGGCCACATGCAACA
CACACTTTAACATGATCCAAAAGAGATGGCGTCCTCGGTTCCCGGGACTTCGATGCATTTTCAACCGAAATTACGTGTCGTATTTCGTGAAAACCGACGC
TCGGCAGTTCGAGTTTGGTGTGAGTGCCCAAGCAACGACGGCGACCAACAAACTGGTCGCACACCGGGTCAAGACCCATTGCCAACTGTGGCAGCCAGTC
TTACGGTCATTGGAGCTTCGGAACCCCGCGATGTCACGTGAAGTATTTGGGCAATTCTGCCACCACCTCGAAAAATGGAAAATGGATTTGCGCGCGATTG
CGCTACGTGCAGCGTCGGAAACGACTTGTATGTCTTTCAAGAAGCGTGTGGGGAGGTATACACGGCTGCTACGTGGCGCTGGCGCGTCTGTGGGCTGCTA
CTCGTCGTTGTGCTGAATGGTGCTCACACTATTTAAGACTAGGTCTTGTGATTGGCTAGAAAGAATCAATAATTCAGCCAATAAACATCCATGCCAGATT
GAGTTCCAAACGAGCCGGATCCGCAAGCACAAGAAGTGGTGTGGACGCGCGCGAACATCGAGAAGGTCCGGTGCGACGAGCGGGTGCACGAAGAGGCAGA
GCGCGGTGCCTTTGAGGAGAAGTACAAGCGGAGCCTCGACGTCCGGGTCGAGGCGCTCAAAAAGACCAAGCCGACGCCGCCGGCCATCGACCTCTTTGTG
TCCACGCCAGTCGCCAGCATCAAGCAATACACTGACGAAGGCATCGCGCTCGGCAGCGCGGTGAGCCCGGTCCACTACCAGATAGGCCGACGCAAGCCGC
CCTCGCAAACCTGTCCTCCAGCAGAGCCAAGACGACAACGACGCCACCGAGGTGCCACGTGCAGCGTACGCCGACCGACCCCATGGCTGCGGTCGTGGGC
CGGCCCAAGGCGCTTATGGCCGCCGCCAACGATACACGGGAAGCCGACGCGCTCGACTTTGCCGGTAATGCTACGAACACGGAGCTCAAGCAGACGAAGA
CAGCCAAGTCATCGTCGTCTTCCTCCAGTCGCCTCGAGCAGCTTCGACGCGAGGCCGTCGAGCAGCGTCAACTCGAGACGCTCCTTCGGCGCTAAAGCAG
ATCTACTCCCTGAGATCTTTGATGCTCTTGAAAGACGGAACGGTGGCGAGATTGGCGTCGAGCACACGTGGTAGCGTCATCATCGGGTGGCGCGGCCACT
GTGCAGCGCCGAAGCGTCCGAAGTTCTCACGCATCGCGATGTTGGCTGGAAGGTTTGGCGCGCTGCGAAGGATGTGACCAAAAAGGCCTCACCGAGCTTA
AGTGACACCTCCGTGAGCCTCTTTTGCGCCTGTACACTTGCGTCAAGGTATTAGCACCGGCGCTTTGCTGCTTCGAACGTTGCTCGAATCGTGCTTGGCA
TCGGTTCTCGCCAGAAGTATTCGCACTCCGCATGAGGACGCAGCATTTTTTGCAAGCGTTTGTCTGTTGGTACACCAATGCCCAGAATTGAAGCGATGAG
TGACGAAAGAAGGACCTCGGCCACACAAGTTTCACCGTCCACAGTCAACAGGACGCCTAGTTGCGACCGCCCTGCCGTGCGATGTGTTGCCGTGCGACCG
AGGCCCTGGAGCGCAAATTGCAGAATGAGCAGCGCTCAAGGTTTTTTTCCGATTCTCGTGTAAAAGCACTGCGTTTCGCCTTTGTCGTGCTCGTCGTTTC
TACACGACTGAACGTTTGCGCGGAAATGGGACCCTCTCCGAGTGCCACGTCATATTGCAATCCATATTTTGCGACCTCTGGCGTACAATTGTACCTAGCC
CTCTATCTGACACTATGTTCAAAGTCATACACTATTACGCAGTCAACTCGCGACTCTTCCCACCCTGCGCCATCGTGTGGAGTCGAGTGTGTAGTCGAAT
GTACATGCACGGTTGCGTCGTATTGGTACGCGCTTACTTTTGCGGCGACTGGCGCTTGACGGGCGTGCGCGACCGACTCGAGCTCGACGAGCGCGAATAC
CGGCGGCGACGCGATCGGCTGCGGCGAGGACTACCGCCGCGTCGGTCCATCGATCGGCGTGGACTAAAGCTACGCCGGCGGAAAGTCGGGCTGCGACGAC
GGGGGCTCGGGCTGCGGCGCCGACCCA