Description :
EST
Sequence
149 bases(100 bases per row)
GGCACGAGCAGAAACGCCAGGAGAGACAGGAGCAGCAGCGCGAGTGGACTGAAAAAGCCGAGAGCGCACCCACGGCGCTCAACCGGTTCTTCAAGAAGTA
GATGCATTCCACACTGTAATACAAGCAGGCGGCCGCTTTCATTAGACGC