Description :
EST
Sequence
198 bases(100 bases per row)
GGGGGGAATCCCGCAAGACCATCAAGAAGGTGTTCGAAGAACGTTACTTGAACCAGGCCGCTTGCAAGTCTGAGAAGAAGGCTGCCGGTGTCAGCTTCTT
CTTCAAGAAGCTCCGCTTCTAAATGCTTTTGACGTGTGCTAGCGTACTTAGAGATACCTGTGAATCGGGGAGTTTAATAATGCAGCTAATTCCAAGTT