Description :
EST
Sequence
213 bases(100 bases per row)
GCGATCGGCGGTCGGCGCATGCGCGCAGCACGACATTTTCAGCGCATCGTCAGTGGTGTGCGTCTAGGCGGCAGGACGGAATGAAGACTTGTCTTTTGGA
AGAGGAAAGAGAGAGAGATGTGACGTCGTTGACTGAAAGCAGAGGGGGAAGCAGAATTTTTCATCACGTATATTTGTTGTTCTCATAGCGAAAGAAAGAG
AGATGCGTTGTGG