Description :
EST
Sequence
115 bases(100 bases per row)
GGGGAGGAACCACTTCGGTGGTCATCCGTAAAAATTGGAACGATACAGAAGAAGATTAGCATGGCCCCTGCGCAAGGACGACACGCATAAATCGAGAAGT
ATCGCAACTTTTTTT