Description :
EST
Sequence
1503 bases(100 bases per row)
GAGCGTAACCACCGAGCGCTCGATGGATGTCAAACACCTTCTCAGCAGCGAGACAGCAGCACTCGTATGCCCGGCATCGTCTACAACGTCCGTCCTCAGC
GCGTCCAGCACGAGCTCGAACAAGGTGAAGCGCGGCTGGGTGGCCCCGTTTCTGTTGCACTTGCACCAGATGCTACGACGTGAGGATTCCACGATCATCC
GCTGGGCTGAGAATGGCATAGCGTTCCAGATCTTGGACAAGGAAGCCATGGCGTCTTTGGTGCTGCCAAAGTACTTTAAGAACAAGAACTTCTCTAGTTT
CCAGCGCCAGCTCAACTACTTTGGCTTCCGCAAGTGGAGCAAAGCCCGGGCACCGTTCCCCACCTACAGTCGCGAGCACTTTACACGGGACGATTACAAT
CAGATGTCGTTGGTCAAGCGCCAGAGCAAACAGTTTCGCAAGCGGAGAGTCGCTTCCGATACCAAACCGTCTGCAATCAGTGGAACTATCGTACTTTCAA
CTAAAGCGATTGCCAGCGACAAGGGGAGCCAGCACCTGGGTGTCGATCCCGAGACAGTCATTATACCAGTGCCCCAGCTCCAGTCTTGTGTCGTGTCTCC
TACGATCGCACCTGCATTTCTCTTCCCCGTGCTCTCTCCTACTCGCAAGATGAACAGCAGTTCCAAACTGCCATCTATCCGTGAGCTGTCGCTGTCGAGT
GTCATGTCGCACGCGGGTATCGGCCAAACCCGTCCTCGCCTTTTGGCTTAAGCAGCTTGTCGCAACCGTCTTCGTCGTCGTCGAGAACTACATCAACACT
GTATCCAAGTCACCTTCAATAGCTTTATTTAACGAATCTCCTCACACTTTTATGCCTTTGCTCCCTCCCTCGACCGCTCTCTTCCAGACGTCAAGGCATT
TGACTATCAACTGAATCGAGCCAGGTCCACTCTACAAATTCCGAACAGCCAGTCGAATGACCGTTCAAGATCGCGATCTTTTGCGGCACCCCTTCCCCCC
ACCGCAGATACGCCCTCCACTACCATCATTTGTACTTCCACCCGATCACACTTCTATCACCAAGCTTCAGCCATGTCGAGACTGCAGCTACTGGTTCTGC
TCGCGACTGGCGTGCTCTCGCCCGTACAAGCTTGCACAATGATCGCTGTAGGGCGCAATGCAACGGTGGACGGCTCGACGCTAGTGGCTCATACGGACGA
TGCAGGCTTCGGTGCTGCCGACCTCCGGATGGTGCGTGTCCCCGCTCTGGACTTCGACGAAGCAGCCGTTCGGCACGTGTACAACTTCCAGCCAGGTTAC
CCGCGACTCGTGACGACTGAGAGAGGACCGGAGTACGCGCCAAAGAACGAGCACGAGCAGGTCATGACGCCACTGGGTCAGATCCCTCAGGTGTCGCACA
CGTACGGCTACTTTGACCAGGACTATGGGTTCATGAATGAGGTGCAGCTCAGTATCGGGGAGAGCACCAGTGGCGCCAAGACGGCAGGCTGGCCAACGGA
CGC