Description :
EST
Sequence
963 bases(100 bases per row)
CTGTCGCTCTTGCTGGTTACACGGCCGGCGGCTGCCAGCTCTCCGGCAACATCCTGTACTCGATCGTGAGNCACGTCGAACCCGCTTGGCTTGGCCCCTC
TGGGCTTCACCGCCGACCGTGGTGCCGTGGTGATGGCCTACNCTGTTCATGCAGGTGCACATTTCGATCGCTTTCTCGACGCTGATGATGCCTCCGTTCT
TCATGGCTGAGCNGTCTGGTTTTGGGCATGCACAAGGGCCCCGANGATCGTCCGCTTCAACGGCGAGGCTGACCAGGCCAACGTNGGACCTTGACATGGA
GATCCAGGAGAAGCGTNTCGTACATGCAGAGCTCAACCCCCATGGACACGGCTAACNCGTCAGGTGTCTGCTTCGAGCCTGGTTGAGANAGACAGAGGGC
CGTATGTCGCACCTGCGCGTCGCTCTGGNAGTTCGGCGAGGAGATCACGGAGGAGCAGCTNTCACGCGCCCTACCGGAACAACCCTCTGCGTTACATTGC
TTCTACGCATTTGCATCATTGCGATCCTGGTGNATTATTGCCGTGCTTGCACGCAAGCGTTTCCTCGACCTGNGAGGACTTTACAGGAGCTACTGCCCAC
ACGANCGAGCTGCTTGCTTTTGCCGCTGATCATCTACCTTCGTGNTATTCTGGAAGAGCATGTCGTTCCTGGACAANGGGCGCATCAATGCTGGTGATTG
TGGTGTGCGCCATTACNTGGCTGCTACGTAATGATCCACGCCGGCAAGNGAGCTGTTCACCCCGTCGGACGACGACACATTATTCCCGNTACTGCGAGAC
GGAATTCCAGGACGAGCCGTNACTACATCCGCAACAACAGCACCAAATAAATCGTAAACAGNCCGCAGCAACTTATAAAGAAAGCTGTGCAGNCTTTACG
GTGTTGTATTGCATAGAGGGGTTCACTTTGTAGAGCAACAACAAATATAGTGTATCGTGTGGT