Transcript Name :
Phyta_totarag6373
Orientation:
(-)
Number of Exons:
5
Description :
hypothetical protein PHYSODRAFT_486841
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-530
NN-scoreoddsWeighted Score
0.5591.2360.002
*** None ***
TypeScore
cytoplasmic435
GO
*** None ***
*** None ***
*** None ***
Sequence
        2994 bases(100 bases per row)
ATGGCTCCCAAGAACCAGGAAACTCTGCCCATTAAAAACGCACTGAACCTTAAGGCCAAGCACGCAAAGATCGAGCATCCACAACTGCTGGGAACCTTCC
CTCCAACCACGTACGACCTGATCCCCGTGCTGCCGTACGAAGACCGTGCGCTCAAGGCCGACCCGAGTTTCAAAAATCTGCTGGCTGACGCGACGGTAAC
GCATCTAGAGCCGAAGATCGGCACCGAGATTTCGggtctgcagctgcacgaactAACGGACGTACAGAAGAATGAGTTGGCGCTGCTTATCTCCCATCGC
GGCGTGGTCTTCTTCCGTGATCAGAGGGTCTCAGCCGAGCAGTTGTTGGATCTTGGTCGCTACTACGGCCCTCTGCATATCCAGCAGAACTTGGCGCAGA
CGAAGGAGTACCCGGAGATGCTGGTTGTCGAGAACTCGGTGGAGACGAGCGCGGTAGTGCTCAAGCGCCACAAATACGATCCGGTGAGCGTTTGGCACAC
GGACGTTTCCTACGAGCGACAGCCTCCATCCTACACTCTTTTCAAAGTGCTGACGAGCcctgctgttggtggtgatACGCTGTGGGCCAGCGCCTACGAA
GCGTACGACCGCCTCACTCCTGCGTTCAAGGAGTTTGTGGAACGACTGGTTGCGGTTCACAGCGGCAAGGTACGGCAACCTGAGATAATGCCCTGGTGTG
TATGTTATATCTGACATGCGTTGAATACCCACAGAGCCAAGCTGACCATGCGATCCAAGCTGGGCGTATCGTCCGACGCCCGGTGGTCGAGTTTGAGCAC
CCAGTTGTCCGCACGCACCCGGTGACTAAGCGCAAAGCGCTTTTCGTGAATGCTGGGTTCACCAAACGCATCAAGGAtctctctgctgctgagtctggTA
CGCGCCTTGTGCAGACAATGTAGTCGCGTTTAACGTGCATTATGGCGGTTAACTCACGACTTTGTACTTCGCTCTGTAGACGTGGTGCTCCAATTCCTTT
TCAAGCACGTCGCCGAAGGTCACGAGTTCCAGGTTCGTTACCACTGGACGAAGGATGCGGTGGCGATCTGGGACAACCGCTCGACGTTTCACTACGCCAC
GTTCGACTACTTGCCGGGGAATCGCCACGCTGTTCGCGTGACGCCCCATGGCGAGATCCCATTTTTCGACCCAGACACCATCGCTCCGTAAGCGGTTTCG
CGGCCGATTGGTCGAATCGCTGTTCTGTTGTTATTCCGCTTAGGAAGCCGCTGAAGTTACTTGGAAGAGAATACAGCTAGTTTGTGTGCTACTTGTAGAC
TTGGTGACAAGGGTACGTTGTGTTATTAGCTGAGGATTTGTCTTCGAGTTACCACAAATGCTCCATCGAGATCACCAAAAAATGCTTTTTCCGGTCAGCC
TTTAATAACGGTGTAATCTATTCTGAAATTCCCCTAATAGGGGGAGTCGAACATTGCAAATCACCCAAAAATAATGAGCGAGGGAAAGACAAAGTCGTAA
GCAAAAACATGGCAACAAGCTGAGCCAAAACGGAAGGGGGGACTCACTTTTTGCTCATTTCTTCTTTCTGATTATCGCACTTAGCCGAAAGTGGGAACGT
TGACGAAACATCCAAACGGCCAGTTCAGATACTGCGGGGGgggagaagatgccgaagcaAAGTGATAggcagcgccttctccggGAGATTGTTGACATCC
TGGCGGTCGCGGTagtcgaggaggaagacgacgacgcgctgggACAGACAGACATTGaccaggatgaagaagttttACTCTTTTCTCAAACTAATGAGGC
TTCTGACTTTCTGATGCTTGTTCAGTCGTCTTGATATTTAGTGAGCAGAGAGCGCGCTACCAAGAGCACCGTGTTTTTGGCGGATACGTTTCGATACTCA
ATTTCCCAGACGCAGTTCCGCGATACAACCTTCATGGACAGGACCTCGTTTGAGAGTGTCGTTTGTGAGTGATCTGCTTGCGTACCAGCAGAGGTACCTG
TGTCTATACAGCAGAGGTGACTACCACGTATACATTCGAGTTGACGATCACGTATATTGCCAAGGTATAGGCGGTGGCTGGCCCGGAGGCGGCCACACGT
TCATCTGTGAGATTTAGAGGTAGATCTAAGTCTAACACACTCAGTTTGATTTTAGCTCGGTAGAGAGCTGATCCCGTACAAGACAGATCATAGCTAGATG
GCTGGCGCTGGTGATGGAGAATctggagctgaagatgaaggcatGCTGACGGCGAGCCCGCTCGCAgcgcagttgcagcagcgggtctcggcagctccag
cgctgccGCAACCTCTGTGATTTGATGGTCGAACGGTGCAAGACCGTCGCGATTTCATGCGAAGGTATGAGACTTACCTTACGGCGATCAACGCTCTACA
GACCAAGTGGAGTGCCGCGTTTGCCATGCTTGTCGGTGCCTGCGTCGagatcaagaccaagcgcatGATTGCTCGGTACGAATTTAACTGCTCGCCCGAG
AAGATCTCGGAAGAGCAGTGGATTGTGTATTTCAAGCAAGCTAACGATCCCTCCCACGTCGACTACGCGGTAGTCGAAGAGGCATGAAGCAACTTCATAT
GCAAACGAAGTGGCCCGAACCAGAGAGCCGCATGATGAATCTCCAGGCGGACCTGGAGACCATCCTCGACTGTTTTAACCCGGCCGAACACGCGttcgag
cacgagcagcgacgccTCGTTCGCTACTTGACGAATGATCTCGAGCCCGCCAGCTTTCGTAGCGTTGTGGCTACCCGCCTCACACTAcaggagaacaaga
agcttAAGAATGAAGTCGTCCCCTTTTGCACGTGGGTCAAGTCGTTGATGGAGGAGTTTATGACATGGGAGCATGCTGCCCAGGCCATAAACAACGGCCC
CGCCCAGCAAGGTAGCGGAGCCAACGCGGCGTCTATCAGCGGTCGTTGTGGAGGCCGCAATGGATCAAATACTGCGAGCAACGGTGGCGGGTGA