Transcript Name :
Phyta_totarag6367
Orientation:
(+)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phox homologous domain11.222PS50195
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-317
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        954 bases(100 bases per row)
ATGAACGTGTTCCAGAGCGGGGTGCAGGTGTTTATCCCGGCGGCGCTCAACCGACCCACGCACACGCTGTACAGCATCTGCATGCTGGTGCAGCCCACTA
ACCAGGAATGGACAGTCAACCGCCGCTACTCgcagttcctgcagctgcgcaaggacATTCAGCACAAACTGGCCACGCGCGGCGTCTCATGCGCGAACTG
CGCCAGCTTTAACCGCGCCATCAGCAAGTTCCACTTCCCAGGCAAGTCCCTGCTGCGGGCCAACTCGGTGGTGCGTCACCGCGTCTCAGCCCTGCAAGAG
tttctcaagctgctggtggggcGCGTGTACAATGATCTCCCCAAGTGCGGCATCTGCGGCGACGAGATTAAGGACATGATGCGGCCGTTCCTCATCCGAG
GAGCACAGCCGATGAACGGTTCAATCATTTCCAAGATCAACAAGTCGCTGTCTTTGGATTCGTACGCCCCAGTGGACCAGCCGGTGGTGCCCGTCCCGGA
ACCGGCACCGCCTATTTCGCCCTCGCTGGTAGGCAGGGAACTTTTCAGtgccagcaagtcgtcgagCAAGCCAATTTTCACACATAGTCAGATTTCAGGC
GGCAAGTCcatcttctcgcgcagcAAGGCGATGCTGAGTACCACATCGGACGATGCATCCACACAGCCGAACGAGTCGGAAGACCCCATCATGGACTACT
CAGACAGCGATGAGGATGGCTACGgcaagaagtacgacgacCAGCGCTGCTACGATGAGGGCGTCCCTCTTGAAGACGCTATGAAGCAGGTGGTGTTGCC
CGAAGGAGCTCGCCTTACATGTGAAGAGGTGGTTGCTCGGCTCACGTCCATGTGGGCCACGTACGACCTGGAGGAGGCACTTTCATCTTTACCACCCGAG
CGGCTTTCAGAACAAGCCAATTTCTCTGTAGACGAGAAGGAATACGCTTTTTAA