Transcript Name :
Phyta_totarag5174
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_473874
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
G-protein beta WD-40 repeat3.1PR00320
G-protein beta WD-40 repeat3.1PR00320
G-protein beta WD-40 repeat3.1PR00320
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain18.22PS50294
WD40 repeat12.346PS50082
WD40 repeat10.007PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat230SM00320
WD40 repeat9.1SM00320
WD40 repeat0.14SM00320
WD40 repeat6.1SM00320
WD40 repeat280SM00320
WD40 repeat21SM00320
WD40 repeat200SM00320
WD40 repeat120SM00320
WD40 repeat180SM00320
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
G-protein beta WD-40 repeatIPR020472
Y-scoreD-scoreY-pos
0.7560.85925
InsideOutsideTMhelix
1-1148
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3447 bases(100 bases per row)
ATGGCGTCGATACAGAAGCAGGAGTTCCTGGGCGCCGTGACGCTCGTTACGTTCTCATCAGATGGGTCTATACTCTACGTAGGCGTGGGACCATCGCTCT
CTCTTTATGCAACCGCTACGGGAGAGCTGCTGAGCGAACACACTGTCTTGACGCGAGGCATTCTGCACGGCTGCGACATCGTCGGActtcctggcgctgg
cgctggcgctACAACGGACTCATTTGCTGGCGCTTTCTTCGGTCAAAAGCGTGTGTCGTGTTTTCAGAACTTGCCGCAGACTCGTGAGGCTGCTCAGGGG
CTTGAGGAGCTCACGACGCTGGGCAAACCGAAAGTGTTTTGCGACTGGGTGTTcgacgtgcagctgctgacggatGACTTTGCGTcggaggagaacaaga
agctgctggctgcagtTGGACTTGCTCACAATTTAGTGCAATTATGGGATCCTGAGAGCAGCAATATTTTACGCAGCGTGCAGTGTGCCGAGCGCTGCAT
TTTGTACGCGTTGGCGTTTCACGGACGATCGCTGGACGAGCTTGTGGTCGCTTCGGGAACGGTATTTCAGCAGATTTTGCTGTGGAATCCGATGGAGAAT
GGAAGGGAAGAGGcgagcgctgctgtcgaccCGGCGCAACGGCTGCATGCTCACGATGGCGTCCTCTTCAAGTTGGCGTGGTCGTCAGATGCGCGCTCGT
TGGTCTCCGTCTCGGACGATCGCACAGTGCAGCTGTGGTCAAACAATGGGAAAACTACGGTTGAGCAACTGCAGTTGCTGAGAACGTCGAACCGTGCTGG
ACTACTTGCGAATGCGTACTCTCCAGTGTTCCGAGCCTGGGGTCACTCGGCGCGCATTTGGGATGTTTCTTTCTGGGAGCGCGGTGTGGTAACGGCGAGC
GAAGATGGTCTATCCAAGCTCTGGGATCTTAACGGCGACTGTGTAGCCACGTTGCAAGGACACATGGGCAGACATGTATGGCGTGCAGCCGTCCACCCGT
CGCAAAAGATGATTGCCACGGGAGGAGGTGATGGCGCTGTCAAACTCTGGGATATTACACACCAGCTCATGTCTTCTTCCAACGCATTGGGGGCAAGTAA
CTTGTGTAAAACTATTCGTGTTCCTATTTCGACAACGTGTACTGCATcgaaaaagaagaagagtggCCCATCGTCTCACAGTGTGCGTAACATCGTGCTC
AGCACTCTGGACAGCGGCAAGACGGCATTTGTAGCTTCCGAGCACGGCGAGATTTTCCGTCTGGACCTGCCATCATTCGCAGCAGAACTCTTTTTCGCTA
TCCCTCCTTTtgacggtgctgccgttcaaAGCCGAACTGGTGGACTGTCGACGTTCGCAATTGATTTTTCTGGgcacttcttgctgcttggtgatgTAAC
GGGTCGCGTGTGTGTTGTTGAAGCATCTACGGGCATTCTGTTGTACTCATGGACTACCCAGACCAACGTTCGGGTTATGAAGATTTGGTGGGATCAGGAA
GACTCGCTATTCATTAGTAGTGCTAACGGCGTCCTCACTGAGTGGAAACCTGCCATTGTAGAGGCAGGCGACACCCTGACACCACCGTCCATCGCAATGG
ATCTTATGGCAACGTTCAAGATCCCTGCCAAAAGCTCAATGTCATCAATCCTGGTGGTAGACCGATTGGCTAAGACCAGGAATATCATGGGAGGTGACGG
GCATGGTAACGTGTACGTCTTTCACCGCCCCCTTGTTCGGAAGGGCAGCGACAATGAATTCGATGTGGCGCGACCCCCTGCTCTCGTGCTTAAAGGTGCC
CACGGGCGTGAACTGGTGGCATCACTTCTACTCGACGATGCTCAAAACCGCCACATCACCATGCTGTCGGGAGGCCATGACGGGTACATTTGCTCGTATG
CACTAGAAGAAGATGCAAGTGGAGCACTGACAGCTGCACAGTTAGGCCGTGAATCCATCCGAGGTATCTCCACAGTCAAGCAGCTTTGGTGGAGCCAACC
TTTATCTTCCAGCGGCACGACAAAGAATGACCTCATGGTTTTTGGCTTCCACGCGTCACAAGCTATTCTGTACAACTTGTCTGCGCAATATCGTGTCTTC
AACGTGGCATGCGGTGGTTGGCGTCGCCCCCATGCGCTTTGCATCCGTGGGGATGAGACAGAGTCGGCCTTACCCTCTCATACATTTGTGTTCACGCCCC
CGGCAACACAAAAGCAACAGGTTGATATTAAAGTGCACTCTACTCTTCTGCCTGAGCACGGTGCTTCCAGGACTTCTCCATTTTTCTCTAGATGCTCTCT
GCACGACCATCATCACTGGCGCATGACGACTTGCGTGGCTTTCCTCGGAAGTGAGCGGTTGGTTACTGCAGCAGAGGACAACAGCCTTATgctgcatcgt
cgtcgcgcTCAATATGGTCAAGAGAAGTGCAGAAGCTTACGTTGGGGCAGCGTGGCTACCGGAATTGCCCATACAACTACTGTCCGGGCACTCACAACGT
TCCGGCGCAAAACTCCTGATGGCGTCGAGGAACACATCGTGCTCTCAGGCGGCGGAAAGCAGCGCCTAAACGTGTGGCTAGTTCCTGGAGAAAGTGACCA
ACTCCGTCATGTCTGCGGCCAGGAACGTGCCGAGACAGCTCAGGACCACCGTATCCTCGGGCTTGCTACGTTTGCGATCCCCTATGTCTCAGACAATTAT
CGGCTTGTGACGGCTTGCAACTCTGAGGGCTCCAttcaattgctgctgctggacgtgaacCGCGGCAAACTTTTCGAGCTTGGTGACTGCCGTTCTGCCT
CAAGAAAACCGATTTTGTCCTGCGTTGGTTTTCAGGAAGGTGATGACGACGCAGTAGTTGCTGGGTTAGCCGTTGGCTCTACTGATGGCTTGGTGACGCT
GTGGGAACTaagcgcgctgctgaaggagattgCTTCGCTTGTTCGATCCAATGAAGATGTGGGGCAGTTCAGGGAAAAGTTACAGGGGCTGATAAGTGAG
TTGCAACCAAGTGGCAACTACTTGGCGCACGATATGGGCATAAACTGCATCAATCTTGTCTCCTGTGCCAAGAGCACAGAAGAGGGGAGCCTTGACGTGA
CATTTATCAGCGGCGGAGACGACCAGAACTTGTATCTGCGTGAACTCCTCTTCCCATCATGCCAAATGCTGTCCGACAATCGGACAGTGAATGCTAGCGG
TTCAGCTATCAAAACTGTTGCATGTGTGAATGCCCAAATCGCTTTTGCCGCTGGCTACGACCAACGAGTGAGCAAATGGAATATTTATCGCAACGAGAAC
GACACCAAGCTGGAGTGGCGAGGTGTTGTATTCTCAGAATGCGCTGATATTGCTGATCTTGCAATACGGCAAACCTCGGCTGGAACGGCTGACGAAGTTG
TGGTCGTTGGTCAAGGCCTGCAGATGATGCAGTTCCAGCGCGACTAG