Transcript Name :
Phyta_totarag2848
Orientation:
(-)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, FYVE-related9.988PS50178
HmmSmart predictionP-Valprediction_id
FYVE zinc finger0.0019SM00064
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
*** None ***
InsideOutsideTMhelix
1-627
NN-scoreoddsWeighted Score
0.5731.3490.003
*** None ***
TypeScore
nuclear739
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
*** None ***
*** None ***
Sequence
        1884 bases(100 bases per row)
ATGAACGCCAGCAACGTCAAGTTCCCACTGCCAGATGGATACTTCCCGCCGGTGAAGCTCACCCCGGCCGAGATTGAGGTCTacgagcagcgcgtggaga
tCATCATGAAGAACGCACTGGCCGAGTACAACCTGCACGAGGCCATGGGCGCCCGACCGGACTATGGATCTCGGTGGACCGACGTGGGGAACGTTGAGCA
CCTGACTGCAATTCGCGAGGTGGACCCGTCCAGGGCAGTCGAGTCCTCGCGCATCTTCGGACGCATCGACGGTGACTACCGCAACTTCATCGACTTCTTC
TACTCGGTCGCGGCTCAGGAAGTTTTCGCGGTGAACCAGTTCATGTTTGGGTACGCGGTGGATGGCGCGGTGCTGTGCAACATCCACACGAAAGAATCGC
AAAAGCCCCATGTGTATCTGGGCATGAAGTGGGTTTGTCTACAGCCGGCAACGCTCTCTCGCAAGCGCGATATGTGCTTTCTCGAGTATCTCGTCTACAC
CAAGGACCTTCAGGGTAGAGACGTTGGCGTCCGCATCACGCTGCCTCTGCTCCTGGACGAGTGTCCGCCGCTACcggacaagctgaagacgcggCGAATT
CATTTGCACACGGTGACGATCGTCCGCCCAACGAATGACAACGCCGACACCACGCAGATCTTCATGACACGTGAGATCGACATGTACAAAGGATCGAATT
CCTCATCCGTTGCTacgttcaagaagctcatgacCACATTGAGCTCCATGGCGTTGTTCGCCGACTCCAAGCGCATTTCGATGCACGGCATGCTGGATCG
CCGGAGCTGGGCACCGAAGAAAGCGCGTGCCGACTGCACCGTGTGCAACCGCAAGTTTTCAACCACGCGACGCCGTCAGCACTGCCGTCTCTGTGGCGAG
GTGGCTTGCCGTCGTTGCATGACGATTCGTGATGCCCCAATGCTTGATGACAGCGCTGCTTCGACGCCGCGTACGTTCCAAGTGGTGAAGACGATGTTCT
GTAAAGCTTGCATGGGCAAGGTTCGTGGCTCCGACGTCAAGAGTGTCGCCGCGACCGACAgccaagatgaaggcgcGTCCGATGCCGAGTCCACGAGTTG
GCTCATGGACAAGGGGTCTCGCAGCCGAAGCTTCGACAACGAGCGCAACTTCGCGATGACTGGTGGATCGTCGATTGCGTCGCTTTCGCCTGTTGATGCG
AGCTCTGCTCGCTCTGCCCCACCGCAAAGAGGCATCATCGGGGATtctgaagatgaagcgagCCCCGTTGAAAGCAGCAGTCTTCCGCAAGGAAAGTTTT
CTAGCAGCATCGACTCCGAGGTGCAGTCCGAAACCAAGACCAGTGTGTCGTCTTCAcaagacgacgagatcgaggtCGAAGTCACAGACTCTGTTGCTCC
CATGATGATCGACCTCCGCCATCTCCGGACAATGGCAGGAGCAGAGCGTGTGGTACAAGaggctgaggaagaagaacttcgGACGATGCGGGAGTCGCTT
GCAGCTTTGGACTTCAAGGCCGTTCGTCTCGTGGATTCGCCGTCGAATGCAGACAGTGAGTCAGCGGAAGGGTTTTCAAGCAACAGGAGCGGCAAGCTGC
CActcatggaggaggaggacgacgacgatgaggacgatgTTATCGAGATTATTGACGAGCCGAACCAGATCGTTTCTACTACACGGCAGATCGTGTCGTC
CCCGCTGGATGAATCACCCCTGGATGGGGGTACACTAGCAGAGCAATCCTTATTCGGATCGGCTCGATCAAACGTGTCGATCGATCAGCGCCTTCAAGAG
CAGGAAGTGCTGTTGAAGCGTCTAGTAATGGCGGCGAACTCCTCCGCCGGATACTACCCACCAAGCGCCCGCGGACAGCAGTAA