Transcript Name :
Phypl_g14756
Orientation:
(-)
Number of Exons:
1
Description :
putative polyprotein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-182
NN-scoreoddsWeighted Score
0.7112.230.004
*** None ***
TypeScore
mitochondrial435
GO
*** None ***
*** None ***
*** None ***
Sequence
        549 bases(100 bases per row)
ATGGTATCTCACGTGCTTCGCCCGCTCCGTGACTTCGCACCGAGCTACTTCGATGACATCTTCGTCCACAGTCGCGCTGAAGGATCACTCAGTGCAGTCG
AAGTTCATCTACGGCACTTGAGACAAGTCTTCCTAGTGATGCGCGAAAACAAGCTGTACACGAACTTGAAGAAATGCGTCTTTTGCGCGCCCGAGATGCC
AGTACTCGGGTGCTATGTAAGCAGAGACGGCGTCCGCGCCGACCCAGAGAAGATCACGTCGATATGTTCTTGGCCAACGCCCACGAATCCCATGGAGCTA
CGCCAGACGCTGGGTCTGGTGAATTACATTCACGAGTATACGAAGAACTACGCCGGACTGATccagccgctgtcgtcgctgctgaagaaagaCACCACGT
GGTCGTGGCGTCCAGAGCACCAGTCAGCCTTCAACTCTGTGAAGAAGAACTTGTCGGATACCCCGATCCTGATGCTTCCGAACGATTCAAAGTCGTTTCA
CGTGGTCTGCGACGCGAGTGACTTCGCCATCGAGTGTGCTTTCGTGTAG