Transcript Name :
Phypl_g14653
Orientation:
(-)
Number of Exons:
1
Description :
Amino Acid/Auxin Permease (AAAP) Family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-11
67-86
144-149
210-221
296-376
425-436
35-43
110-123
173-186
245-272
396-404
457-492
12-34
44-66
87-109
124-143
150-172
187-209
222-244
273-295
377-395
405-424
437-456
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1479 bases(100 bases per row)
ATGGCGCACTCTGCTCTCTTCACGCTCGAAgacgccaaggcggcgttcaacctcttctgctgcgtctaTGGCATTGGAACGCTTGGTATGCCCGGTAACT
TTTCCCGTGCCGGCCCCGTGATCGCAATCATCGCCATGGCCTTTATGGCCTTCGCCAACACGTACTCCTCGGTGGCTATCTGCCGTGTCATGCTGATCGC
TCCGCGTTCCGTCAAGACCTACGGTGACCTCGGAGAATGGTGCATGGGCAAGCCCGGCCGCTACCTCTCGGTTGTCTCTCAAATGGCCAACTGCCTGTTG
GTGCCATGCGTGTTCCTCGTGCTTGGCGGCACGCTCCTGGATGGCCTCTTCCCGGAAGCcttcagctccacgacgtggaTCATCCTCATGGCGCTCTCCT
GCCTGCCTGTGTGCCTGGTTCCGACTCTCaaggaaggagctggcgccgccttcgccggTTGCATGGGAACACTCATCGCGGATATTATCGGTGTCGCTGT
TGTGATGTACGGCATGCGCGGCCACTCGAGTGTGCCTTCGCCCGACCTCACCTTCAAGCAAGTCGCTGGTGCTTTCGGCAACTTGGCCCTTGCGTACGGC
GCCGGTATCGTGATTCCAGCGCTTCAGCGTCAGCACAGCGACCCTACTCGCATGCCTCGTGTGGTGGGCGTGACCATCGCGTTCATCTCGTGCTGTTTCC
TGGTTCTTGCGAGTACGGCGTACTCGGCGGTTGGCTGCCAGATCTCTGGCAACTTGCTGTGGTCGATCTACCCGGACTCGGAGACTGGCTTGACCACACT
AGGCTTCGCATCGGACTGGGGTGCTGTCGTCCTCGCGTATCTCTTCATGCAGCTGCACATCACTatcgccttctccgtcaTTCTGAACCCGGCCTTCTAT
ATTACTGAGCGCCTCGTGCTTGGGATGCACAAGCCTGCCGTTGCTGACGTCGAGAGCAACTTGCTGAGTTACGCCGATGCTGCTACTCCTGCTGATGTTG
CTGAGCACTCGGAGAAGGAGTCCCGTGCTTCCAAGCGCTCATTCATCTCTGTCGCCGACAACGAGAACGTGCATCTCGGTGAGCCTGACGCGGAAGCCGC
CGAGTACCGTGGTGCCAACACCATCAAGTACGTTATTCTTCGTATTGTGATTATCGTGATCTTGGTGATCGCATCGGTGCTTCTGAAGGACCACTTTTCG
GACCTGTCGGATTTTGTCGGCTCGTCGTGCATCACGGTGAACTCGATCATCCTGCCAatcgtgttcctgctgaagaagaagtggaacGTCATGCCGATCT
GGGAGAAGGCCCCGGCGCTTACCGTAGTCGTGGTGTGCTTCTGCCTGGGCTGCTACGTGACGTACACGTCGGGCAAGAACCTGTTCGCtcccagcgacga
cgacgcgtccttCCCCTACTGCGCGCCGGAGTTTGAGAACACCGTGTACTACAACTACACGGCGGAGCACGAGAACTAA