Transcript Name :
Phypl_g14055
Orientation:
(+)
Number of Exons:
5
Description :
protein kinase, putative
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Serine-threonine/tyrosine-protein kinase catalytic domain2.3PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain2.3PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain2.3PR00109
Profile scan predictionP-Valprediction_id
Protein kinase domain37.842PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain2.6SM00220
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8280.8925
InsideOutsideTMhelix
401-721
1-377
378-400
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        2473 bases(100 bases per row)
ATGAATTCTCAGAGGGCGTGggcgtcgctcgtgctgctgttggccaCGCTGCAACTTGCCCCAGTGATAGCGCAAACCTGCAATGCTGAGGgatcgacgc
tgtcgtcgtcctgcggCGGCGTTTGCGACTCGTACCAGCCGTGTCTGGCCTACAACGCCTCAGATAGCACGTCCTGCAACAGCTGCGTGGCCGACGCGGT
GGGCGAGTGCAGCTATGTGTGCTACAATATCTACCGTGACGAGCCTGCGGATATGtcgttcttcgtcttcttcatcacctACGGCACGTAccagagcgag
gaggagctggcagccAGAGCTCAAGACTCCGCGTACGACGCGACTCTGCAGAACCTCCCGGACAACACGAGCACCTACGCCTGGGCGAGTAACAACATCA
TTACGCGGATCGGCACTCTGGACTTGCCGTCCGCTACAGAATCAGTGTAGGTGTCGGGACAGTACTGTAGGAACTTGTTATCCGGGGTTGTTGACTGACC
ACCTCTCTTGCGACGGACACTATAGCGTCCTGGCCGGAGGAACCAATTTCGACTACACATTGAAGTCCAAGGTAGTAAATCTGCAACTCGCAGACGATCT
GCTCACGTCGCAGACGCAAGTGACCCAGGTTTCGCTGCTCTGCATTAACCTGAAAGGGCAGATTGGCACCATCCGGGACCTCCTCCCTTTCTCGACCACG
TACCTGAACCTCGCGAATACGCTGCTTAACGAGTTTCCGACGGAGTTGCTTTCGCTACCATCGATATCCCAGCTGTACGTATGGCGATTTACGCTAAAGC
ACTTTCGTTTCGTGTTCGGGGTGCCCGCCTTATTCTTGATTTGATTTTCCACGCAGGTATCTCAAGATGAATTACATCACGGTAGTGAACTCCTCCATCA
GTTCCACCAAGCTCATCAATCTGTGCGTGATATTCGCTGCTATTCCTCAATGTGTTGTTGATTTATAATGCGTGGTTTATTAAAGTGGGCTATCGGTAAA
TGCCATGACATCCTTCGAGGGTGACTTCCCCAACCTTGCTGTTCTGTAAGTGCTAAGATCTTTTAGCTATTTGAAGTGGGTACCTAACGTTTATTGTTTT
TTCGCGGTGTACTCTAACGACTTCTTAGTGAGCTCGACAAGAACAACTTCACCGAGATCCCCGCTGTCATTTTTACAATGacgtcgttgaagtcgctgTA
CCTCGCAGGAAACCCTTTGAAGACACCGACATTTACAGAAGATCAAGTAAATTTCCTCATGGGCCTCACAGATTTTGACCTGACTGCAGCTGATTTTCAG
GAGGAGGTCAACTGTGAGACGTCTGCACAGGTCACCTTTGAAGGGCTCACGGTGTGCATCAGCGACCGCATGGTGAGTTCGAGCTCGGCAAGTTCTGCTA
CGAGCGATAACGGACCAGGATCAAAGTCGAACTCCAACACGGTGATGATGGTGGCTGTGGCCGTTGGCGGTGTTGTCTTGCTCGCCATCATCGGAGCAAT
CGTGTATTGCCGGAAAGCGCGCAGTGCAGGCAAACCCGAGACTATGGTCATTACAGACCCCACTGTGCGCACCACTCGAGACAATTACGACAACTTGTCG
ATTTGGCGCGATCCCGAACTGCTCTCGCTCCAGGTGAGTGTTGAGGATATCCAGGATATCAGGTTGGTCGGGAGTGGTGCGTTTGGTGTTGTTTGGCTTG
TCCGCTACCGCAGCGCTCAACTTCTTGCTTCGAAGCGACTTCGTGAGGATATGGCGACGCGTGAACGGGTGCAAGACTTTGTTGACGAGATCAAGATGGT
TTCGAAATTTGATCATCCGAATATTGCCAAGTTCGTcggagcagcttggagcaTCGAGTCGGACCTCCAAGCGTTATTTGAGTACATGGAGAATGGCGAC
TTGCGCACGTATCTGTCGGCTTCCTATATGCCGCGCTACTGGACGTCTACGAAATTTCAGTTGGCGATTGATACGATTGAGGCACTCGTTTACGTGCATT
CGTTCGATCCTCCGCTGGTCCATCGCGATCTGAAGTCACGAAATGTACTGATATCGGCAGAGATGCAAGCCAAGTTGACAGACTTCGGTACGACACGCTA
CCGATCGAAGGATGGTACAATGACGATAGGAGTGGGAACTGGTCGGTGGGTGGCGCCAGAGGTCATTTCAGGGAGCACTGAGTACGACCAGAGCGCAGAT
ATCTTCTCCTTTGGGGTGCTTCTGACTGAGATCGATACGCATAACCTCCCTTACTACGACGCCGTTGGACCAAGGGGTAACAAGTTGGAAGAGGTAGCAG
TGCTTCAAATGGTGGCAAACGGCCAGTTGCGTCCGACGATCAGTCCGTCGTGCCCACCGACTATACGAGACCTTGCTATCCTCTGTATGTCCCAAAACCC
ATGCGACCGTCCCGTTGCAGCGGAGATTGGGTACGTGCTGCGAACAGTGCAAAAGGAGATGAGTAGTGTGTGA