Transcript Name :
Phypl_g13546
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_341850
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Chromo domain/shadow12.901PS50013
HmmSmart predictionP-Valprediction_id
Chromo domain/shadow3.3SM00298
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Chromo domain/shadowIPR000953
*** None ***
InsideOutsideTMhelix
1-246
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        741 bases(100 bases per row)
ATGGGACCGAGGTCGAcactggaggcggcgctgtctGTTGGCAATGTGTCTCACcgcgaggccgaggccagACGCTGGCGATTGCGGATCCAGAGGCACT
ACAAGATcgcacgagctcaagcgctggaGTTAGTCCGAGAGGCGGTCGAAGCGAGAGCACGACAGCAGAGCGAGATCGCAACCAAACACGCGATCGAGGC
CGGAGGGCGAGTGTGGCTTTACCTGGATCGAGTGAAGCCGGGGTACGTGCGCAAGCTTGCACACATGTGGCATGGGCCGTTCCgtgtcgtcgagctggtg
gacacgTTCATCGCGCGACTTGAGATGAACGGTACGCCCTATCAGCTCTACCCGATCGTGCACatctccaagttgaagcccgTCTGGGAGTTCCCGGCAC
GCCCGGCGATACCGCTGACGGTGCCGGCCAGTGAGCGTTTCGATTTCGATGAAGAGCTCTTGCCAGAGGACAGCTGGGAAGCGGAGGAGTTGGATGACGA
CACCTTCGAGGTCGAAGAGATCCTGGACATGCGCGAGGGCCGAGCCACGCGATATAGCCGCACGCGGCGCGAGTTCGAAGTGAGGTGGAAGGGTTACCCC
GACACGACGTGGGTCGATGAGCTGGATCTCAACTGTGGCGGAATCCTGTACGACTTCTTGAGGCAGCGCACGGGGCGCAACCAGTTCGGCGTGATGCAGT
CGCGCgagaacgcggcggcggagccCGACCAAGGTGGGTGA